[US Patent & Trademark Office, Patent Full Text and Image Database]
[Home] [Boolean Search] [Manual Search] [Number Search] [Help]
[Bottom]
[ View Shopping Cart] [Add to Shopping Cart]
[Image]
  ( 1 of 1 )
United States Patent 8,987,548
Sebastian March 24, 2015
Soybean plants having superior agronomic performance and method for their production

Abstract

This invention provides compositions including favorable alleles of marker loci associated with genetic elements contributing to superior agronomic performance. Also provided are markers for identifying favorable alleles of marker loci associated with genetic elements involved in superior agronomic performance, as well as methods employing the markers.

Inventors: Sebastian; Scott (Polk City, IA)
Applicant:
Name City State Country Type

Sebastian; Scott
Polk City
IA
US
Assignee: Pioneer Hi-Bred International, Inc. (Johnston, IA)
Family ID: 34119823
Appl. No.: 13/104,432
Filed: May 10, 2011
Prior Publication Data
Document IdentifierPublication Date
US 20110258733 A1Oct 20, 2011
Related U.S. Patent Documents
Application NumberFiling DatePatent NumberIssue Date
10901425Jul 27, 20047973212
60492074Aug 1, 2003
60547811Feb 25, 2004
60582241Jun 22, 2004

Current U.S. Class: 800/267; 800/312
Current CPC Class: A01H 5/10 (20130101); C12Q 1/6895 (20130101); A01H 1/02 (20130101); A01H 1/04 (20130101); C12Q 2600/13 (20130101); C12Q 2600/156 (20130101)
Current International Class: A01H 1/04 (20060101); C12Q 1/68 (20060101)

References Cited [Referenced By]
U.S. Patent Documents
5437697 August 1995 Sebastian et al.
7973212 July 2011 Sebastian
2002/0129402 September 2002 Lightfoot et al.
2002/0133852 September 2002 Hauge et al.
2002/0144310 October 2002 Lightfoot et al.
2003/0150016 August 2003 Han et al.
Foreign Patent Documents
WO 98/49887 Nov 1998 WO
WO 99/31964 Jul 1999 WO
WO 00/18963 Apr 2000 WO

Other References

Orf et al (Crop Sci. 39: 1642-1651, 1999). cited by examiner .
United States of America, Secretary of Agriculture, Plant Variety Protection Certificate No. 200400078 for Soybean 93M50 dated Aug. 16, 2004. cited by applicant .
United States of America, Secretary of Agriculture, Plant Variety Protection Certificate No. 200400077 for Soybean 93M92 dated Aug. 19, 2004. cited by applicant .
United States of America, Secretary of Agriculture, Plant Variety Protection Certificate No. 200400076 for Soybean 93M93 dated Aug. 19, 2004. cited by applicant .
United States of America, Secretary of Agriculture, Plant Variety Protection Certificate No. 200000037 for Soybean 91B53 dated Apr. 24, 2001. cited by applicant .
United States of America, Secretary of Agriculture, Plant Variety Protection Certificate No. 200400083 for Soybean 92M91 dated Aug. 16, 2004. cited by applicant .
United States of America, Secretary of Agriculture, Plant Variety Protection Certificate No. 200400081 for Soybean 93M10 dated Aug. 16, 2004. cited by applicant .
United States of America, Secretary of Agriculture, Plant Variety Protection Certificate No. 200400079 for Soybean 93M30 dated Aug. 16, 2004. cited by applicant .
Arahana et al., "Identification of QTL's for Resistance to Sclerotinia sclerotiorum in Soybean". Crop Science, vol. 41, pp. 180-188 (2001). cited by applicant .
Burnham et al. "Quantitative Trait Loci for Partial Resistance to Phytophthora sojae in Soybean", Crop Sci., vol. 43, pp. 1610-1617 (2003). cited by applicant .
Chapman et al., "Quantitative trait loci for agronomic and seed quality traits in an F.sub.2 and F.sub.4:6 soybean population", Euphytica, vol. 129, pp. 387-393 (2003). cited by applicant .
Charlson et al., "Associating SSR Markers with Soybean Resistance to Iron Deficiency Chlorosis", J. Plant Nutr., vol. 26, pp. 2267-2276 (2003). cited by applicant .
Cregan et al., "An intergrated genetic linkage map of the soybean", Crop Sci., vol. 39, pp. 1464-1490 (1999). cited by applicant .
Delanney et al., "Relative contribution among ancestral lines to North American soybean cultivars", Crop Sci., vol. 23, pp. 944-949 (1983). cited by applicant .
Hartwell et al., "Genetics From Gents to Genomes", The McGraw-Hill Companies, Inc., ISBN 0-07-540923-2 two pages and pp. 311-325 (2000). cited by applicant .
Kim et al., "inheritance of Partial Resistance to Sclerotinia Stem Rot in Soybean," Crop Sci., vol. 40, pp. 55-61 (2000). cited by applicant .
Li et al., "Molecular Mapping Genes Conditioning Reduced Palmitic Acid Content in N87-2122-4 Soybean," Crop Sci., vol. 42, pp. 373-378 (2002). cited by applicant .
Narvel et al., "Development of multiplex sets of simple sequences repeat DNA markers covering the soybean genome", Molecular Breeding, vol. 6, pp. 175-183 (2000). cited by applicant .
Narvel et al., "Simple Sequence Repeat Diversity Among Soybean Plant Introductions and Elite Genotypes," Crop Sci., vol. 40, pp. 1452-1458 (2000). cited by applicant .
Njiiti el al., "Resistance to Soybean Sudden Death Syndrome and Root Colonization by Fusarium solani l. sp. Glycine in Near-Isogenic Lines", Crop Sci., 38, pp. 472-477 (1998). cited by applicant .
Orf et al., "Genetics of soybean agronomic traits l: comparison of three related recombinant inbred populations", Crop Sci., vol. 39, pp. 1642-1651 (1999). cited by applicant .
Reyna et al., "Evaluation of Marker-Assisted Introgression of Yeild QTL Alleles into Adapted Soybean", Crop Sci., vol. 41, pp. 1317-1321 (2001). cited by applicant .
Specht et al., "Soybean Yield Potential--A Genetic and Physiological Perspective", Crop Sci., vol. 39, pp. 1560-1570 (1999). cited by applicant .
Various seed catalogs, pp. 1-53, 1999. cited by applicant .
Wang et al., "Identification of putative QTL that underlie yeild in interspecific soybean backcross populations", Theor. Appl. Genet., vol. 108, pp. 458-467 (2004). cited by applicant .
Yuan et al., "Quantitative trail loci in Two Soybean Recombinant Inbred Line Populations Segregation for Yield and Disease Resistance", Crop Sci., vol. 42, pp. 271-277 (2002). cited by applicant .
Zhang et al., "QTL mapping of ten agronomic traits on the soybean (Glycine max L. Merr.) genetic map and their . . . ", Theor. Appl. Genet., vol. 108, pp. 1131-1139 (2004). cited by applicant .
Zhu et al., "Molecular breeding for grain yield in barley: an evaluation of QTL effects in a spring barley cross", Theor. Appl. Genet., vol. 68, pp. 772-779 (1999). cited by applicant.

Primary Examiner: Fox; David T
Assistant Examiner: Robinson; Keith
Parent Case Text


CROSS REFERENCE TO RELATED APPLICATIONS

This application is a continuation of U.S. Patent Application Ser. No. 10/901,425, filed on Jul. 27, 2004, which claims the benefit of U.S. Provisional Patent Application Ser. No. 60/582, 241, filed Jun. 22, 2004, U.S. Provisional Patent Application Ser. No. 60/547,811, filed Feb. 25, 2004, and U.S. Provisional Patent Application Ser. No. 60/492,074, filed Aug. 1, 2003, the disclosures of which are incorporated herein by reference in their entirety for all purposes.
Claims


What is claimed is:

1. A method of identifying a first soybean plant or germplasm that displays increased yield, the method comprising: detecting in a genome of the first soybean plant or germplasm at least one allelic form of a set of chromosome segments, each segment in said set comprising a genetic element contributing to increased yield and each segment in said set comprising or proximal to a marker locus selected from the group of marker loci consisting of: Satt684, Satt165, Satt042, Satt364, Satt454, Satt526, Satt300, Satt591, Satt155, Satt385, Satt225, Satt236, Satt511, P12390B-1, Satt480, Satt632-TB, Satt233, Satt327, Satt329, Satt508, P10635A-1, Satt409, Satt228, Satt429, Satt426, Satt509, SAT.sub.--261, Satt197, Satt519, Satt597, SCT.sub.--026, Satt415, Satt583, Satt430, P12198A-1, P8584A-1, Satt359, P10648A-1, P12105A-1, P10641A-1, Satt168, Satt556, Satt272, Satt020, Satt066, Satt534, P10638B-2, Satt399, Satt361, P10639A-1, Satt661-TB, Satt190, SAT.sub.--311-DB, Satt338, Satt227, Satt640-TB, Satt422, Satt457, Satt557, Satt319, SAT.sub.--142-DB, Satt460, P13073A-1, Satt307, SCT.sub.--028, Satt433, Satt357, Satt321, Satt267, Satt383, Satt295, Satt203, Satt507, SAT.sub.--110, P10620A-1, Satt129, Satt147, Satt216, SAT.sub.--351, P10621B-2, Satt701, Satt634, Satt558, Satt266, Satt282, Satt537, Satt506, Satt546, P13072A-1, Satt582, Satt389, Satt461, Satt311, Satt514, Satt464, Satt662, Satt543, Satt186, Satt413, Satt672, P13074A-1, P10624A-1, Satt573, Satt598, Satt204, Satt263, Satt491, Satt602, Satt151, Satt355, Satt452, SAT.sub.--273-DB, Satt146, Satt193, Satt569, Satt343, Satt586, Satt040, Satt423, Satt348, Satt595, P10782A-1, P3436A-1, P10598A-1, Satt334, Satt510, Satt144, Satt522, P9026A-1, P10646A-1, P5219A-1, P7659A-2, Satt570, Satt356, Satt130, Satt115, Satt594, Satt533, Satt303, Satt352, Satt566, Satt199, Satt503, Satt517, Satt191, SAT.sub.--117, Satt353, Satt442, Satt279, Satt314, Satt142, Satt181, Satt367, Satt127, SCTT012, Satt270, Satt292, Satt440, P10640A-1, Satt249, SCT.sub.--065, Satt596, Satt280, Satt406, Satt380, Satt183, Satt529, Satt431, Satt242, Satt102, Satt441, Satt544, Satt617, Satt240, P10618A-1, Satt475, Satt196, SAT.sub.--301, Satt523, Satt418, Satt398, Satt497, Satt284, Satt166, Satt448, Satt373, Satt513, P12394A-1, Satt590, Satt567, Satt220, Satt536, Satt175, Satt677, Satt680, P10615A-1, Satt551, Satt250, Satt346, Satt336, SAT.sub.--330-DB, P13069A-1, P5467A-1, P5467A-2, Satt584, SAT.sub.--084, P3050A-2, SAT.sub.--275-DB, Satt387, Satt549, Satt660, Satt339, Satt255, Satt257, Satt358, P12396A-1, Satt487, Satt259, Satt347, Satt420, Satt576, Satt550, Satt633, Satt262, Satt473, Satt477, Satt581, P11070A-1, Satt153, Satt243, P8230A-1, P10623A-1, P10632A-1, P10793A-1, P12391A-1, P13560A-1, P13561A-1, P2481A-1, Satt040, Satt108, Satt109, Satt111, Satt176, Satt219, Satt299, and Satt512; wherein said set of chromosome segments comprises segments that comprise or are proximal to between about 10% and about 100% of said marker loci; thereby identifying a first soybean plant or germplasm with increased yield.

2. The method of claim 1, wherein the set of chromosome segments comprises segments that comprise or are proximal to between about 50% and about 100% of the marker loci of claim 1.

3. The method of claim 1, comprising determining the favorable allelic form of at least one chromosome segment, wherein the favorable allelic form of at least one chromosome segment is determined by: a) identifying at least one polymorphic marker locus selected from the marker loci of claim 1 in a plurality of progeny of a progenitor soybean plant; b) assessing yield in at least two progeny plants, which progeny plants have different allelic forms of the at least one marker locus; and, c) identifying the progeny plant with increased yield relative to the progenitor soybean.

4. A method of identifying a progeny soybean plant with increased yield, the method comprising: detecting in a genome of a plurality of progeny of a progenitor soybean a set of chromosome segments, each chromosome segment comprising at least one allele of one or more segregating marker loci, each of which segregating marker loci comprises a first allele and a second allele, which first allele correlates with increased yield and which second allele does not correlate with increased yield relative to the mean yield of the plurality of progeny of the progenitor soybean, wherein the set of chromosome segments comprises between about 10% and about 100% of the marker loci selected from the group consisting of: Satt684, Satt165, Satt042, Satt364, Satt454, Satt526, Satt300, Satt591, Satt155, Satt385, Satt225, Satt236, Satt511, P12390B-1, Satt480, Satt632-TB, Satt233, Satt327, Satt329, Satt508, P10635A-1, Satt409, Satt228, Satt429, Satt426, Satt509, SAT.sub.--261, Satt197, Satt519, Satt597, SCT.sub.--026, Satt415, Satt583, Satt430, P12198A-1, P8584A-1, Satt359, P10648A-1, P12105A-1, P10641A-1, Satt168, Satt556, Satt272, Satt020, Satt066, Satt534, P10638B-2, Satt399, Satt361, P10639A-1, Satt661-TB, Satt190, SAT.sub.--311-DB, Satt338, Satt227, Satt640-TB, Satt422, Satt457, Satt557, Satt319, SAT.sub.--142-DB, Satt460, P13073A-1, Satt307, SCT.sub.--028, Satt433, Satt357, Satt321, Satt267, Satt383, Satt295, Satt203, Satt507, SAT.sub.--110, P10620A-1, Satt129, Satt147, Satt216, SAT.sub.--351, P10621B-2, Satt701, Satt634, Satt558, Satt266, Satt282, Satt537, Satt506, Satt546, P13072A-1, Satt582, Satt389, Satt461, Satt311, Satt514, Satt464, Satt662, Satt543, Satt186, Satt413, Satt672, P13074A-1, P10624A-1, Satt573, Satt598, Satt204, Satt263, Satt491, Satt602, Satt151, Satt355, Satt452, SAT.sub.--273-DB, Satt146, Satt193, Satt569, Satt343, Satt586, Satt040, Satt423, Satt348, Satt595, P10782A-1, P3436A-1, P10598A-1, Satt334, Satt510, Satt144, Satt522, P9026A-1, P10646A-1, P5219A-1, P7659A-2, Satt570, Satt356, Satt130, Satt115, Satt594, Satt533, Satt303, Satt352, Satt566, Satt199, Satt503, Satt517, Satt191, SAT.sub.--117, Satt353, Satt442, Satt279, Satt314, Satt142, Satt181, Satt367, Satt127, SCTT012, Satt270, Satt292, Satt440, P10640A-1, Satt249, SCT.sub.--065, Satt596, Satt280, Satt406, Satt380, Satt183, Satt529, Satt431, Satt242, Satt102, Satt441, Satt544, Satt617, Satt240, P10618A-1, Satt475, Satt196, SAT.sub.--301, Satt523, Satt418, Satt398, Satt497, Satt284, Satt166, Satt448, Satt373, Satt513, P12394A-1, Satt590, Satt567, Satt220, Satt536, Satt175, Satt677, Satt680, P10615A-1, Satt551, Satt250, Satt346, Satt336, SAT.sub.--330-DB, P13069A-1, P5467A-1, P5467A-2, Satt584, SAT.sub.--084, P3050A-2, SAT.sub.--275-DB, Satt387, Satt549, Satt660, Satt339, Satt255, Satt257, Satt358, P12396A-1, Satt487, Satt259, Satt347, Satt420, Satt576, Satt550, Satt633, Satt262, Satt473, Satt477, Satt581, P11070A-1, Satt153, Satt243, P8230A-1, P10623A-1, P10632A-1, P10793A-1, P12391A-1, P13560A-1, P13561A-1, P2481A-1, Satt040, Satt108, Satt109, Satt111, Satt176, Satt219, Satt299, and Satt512.

5. The method of claim 4, wherein the first allele that correlates with increased yield and the second allele that does not correlate with increased yield are determined by: a) identifying at least one polymorphic marker locus selected from the marker loci of claim 6, which polymorphic marker locus comprises at least two alleles segregating in a plurality of progeny of a progenitor soybean; b) assessing yield in at least two progeny plants, which progeny plants have different alleles of the at least one polymorphic marker locus; and, c) identifying the progeny plant with increased yield relative to the mean yield of the plurality of progeny of the progenitor soybean.

6. The method of claim 4, wherein the plurality of progeny are obtained by selfing a progenitor soybean.

7. The method of claim 4, wherein the plurality of progeny are obtained by crossing a first progenitor soybean and a second progenitor soybean

8. The method of claim 7, wherein a first progenitor soybean comprising a strain of elite germplasm is crossed with a second progenitor soybean comprising a different strain of elite germplasm to generate a population of soybean plants from which the progeny is selected

9. The method of claim 7, wherein a first progenitor soybean comprising a strain of elite germplasm is crossed with a second progenitor soybean comprising a strain of exotic germplasm to generate a population of soybean plants from which the progeny is selected.

10. The method of claim 8, wherein one or both of the elite strains of germplasm is selected from the group consisting of: 90A07, 90B11, 90B31, 90B43, 90B72, 90B73, 91B01, 91B12, 91B33, 91B52, 91B53, 91B64, 91B91, 91B92, 92B05, 92B12, 92B23, 92B38, 92B52, 92B63, 92B74, 92B75, 92B84, 92B95, 92M30, 92M31, 92M70, 92M71, 92M72, 92M80, 92M91, 93B01, 93B09, 93B11, 93B15, 93B25, 93B26, 93B36, 93B41, 93B45, 93B46, 93B66, 93B67, 93B68, 93B72, 93B82, 93B84, 93B85, 93B86, 93B87, 93M10, 93M30, 93M40, 93M50, 93M60, 93M80, 93M90, 93M92, 93M93, 94B01, 94B23, 94B24, 94B53, 94B54, 94B73, 95B32, 95B33, 95B34, 95B53, 95B95, 95B96, 95B97, 96B21, 96B51, 97B52, 97B61, BEDFORD, CX105, CX232, CX253, CX289, CX394C, CX469C, ESSEX, FORREST, HS93-4118, HUTCHESON, JIM, KORADA, PHARAOH, S0066, S0880, S1990, 519T9, S20F8, S25J5, S32Z3, S33N1, S38T8, S3911, S4260, S42H1, S43B5, S5960, S6262, ST0653, ST1073, ST1090, ST1570, ST1690, ST1970, ST2250, ST2488, ST2660, ST2686, ST2688, ST2788, ST2870, ST3171, ST3630, ST3660, ST3870, ST3883, TRACY, TRAILL, and YOUNG.

11. A method of identifying a first soybean plant or germplasm that displays increased yield, the method comprising: detecting in a genome of the first soybean plant or germplasm at least one allelic form of a set of chromosome segments, each segment in said set comprising a genetic element contributing to increased yield and each segment in said set comprising or proximal to a marker locus selected from the group of marker loci consisting of: Satt642, Satt042, Satt364, Satt454, Satt526, Satt300, Satt591, Satt155, Satt385, Satt511, P12390B-1, Satt632-TB, Satt429, SAT.sub.--261, Satt197, P10641A-1, Satt556, Satt534, P10638B-2, Satt399, Satt361, P10639A-1, Satt661-TB, Satt190, SAT.sub.--311-DB, Satt338, Satt640-TB, Satt557, Satt319, SAT.sub.--142-DB, Satt460, Satt433, Satt357, Satt321, Satt295, Satt203, Satt507, Satt129, Satt147, SAT.sub.--351, P10621B-2, Satt558, Satt701, Satt634, Satt582, Satt389, Satt464, Satt662, Satt672, Satt573, Satt598, Satt263, Satt602, Satt151, SAT.sub.--273-DB, Satt146, Satt193, Satt569, Satt176, Satt343, Satt586, Satt040, Satt595, P10782A-1, Satt334, Satt144, Satt522, Satt570, Satt356, Satt533, Satt199, Satt517, Satt191, SAT.sub.--117, Satt279, Satt181, Satt127, Satt270, Satt292, SAT.sub.--065, Satt596, Satt406, Satt380, Satt183, Satt529, Satt242, Satt617, Satt240, SAT.sub.--301, Satt418, Satt398, Satt497, Satt166, Satt448, Satt373, Satt513, P12394A-1, Satt536, Satt175, Satt677, Satt680, P10615A-1, Satt551, Satt346, Satt336, SAT.sub.--330-DB, P13069A-1, P5467A-1, P5467A-2, SAT.sub.--084, SAT.sub.--275-DB, Satt660, Satt339, P12396A-1, Satt358, Satt487, Satt259, Satt420, Satt576, Satt633, Satt477, Satt581, Satt153, Satt243, P10793A-1, P12391A-1, P12392A-1, P13560A-1, P13561A-1, Satt040, Satt111, Satt176, Satt219 and Satt299; wherein said set of chromosome segments comprises segments that comprise or are proximal to between about 10% and about 100% of said marker loci; thereby identifying a first soybean plant or germplasm with increased yield.

12. A method of identifying a first soybean plant or germplasm that displays increased yield, the method comprising: detecting in a genome of the first soybean plant or germplasm at least one allelic form of a set of chromosome segments, each segment in said set comprising a genetic element contributing to increased yield and each segment in said set comprising or proximal to a marker locus selected from the group of marker loci consisting of: Satt684, Satt042, Satt364, Satt454, Satt526, Satt300, Satt591, Satt155, Satt385, Satt632-TB, Satt429, SAT-.sub.--261, P10641A-1, Satt556, P10638B-2, Satt399, Satt361, Satt661-TB, Satt190, SAT.sub.--311-DB, Satt338, Satt640-TB, Satt557, Satt319, SAT.sub.--142-DB, Satt321, Satt203, Satt129, Satt147, SAT.sub.--351, P10621B-2, Satt701, Satt634, Satt582, Satt389, Satt464, Satt662, Satt672, Satt573, Satt598, Satt263, Satt151, SAT.sub.--273-DB, Satt146, Satt193, Satt569, Satt343, Satt586, Satt040, Satt595, Satt334, Satt144, Satt522, Satt570, Satt356, Satt199, Satt517, Satt191, Sat.sub.--117, Satt279, Satt181, Satt127, Satt270, Satt292, Sat.sub.--065, Satt596, Satt406, Satt380, Satt183, Satt529, Satt242, Satt617, Satt240, SAT.sub.--301, Satt418, Satt398, Satt497, Satt166, Satt448, Satt373, Satt513, P12394A-1, Satt536, Satt175, Satt677, Satt680, P10615A-1, Satt551, SAT.sub.--330-DB, P13069A-1, P5467A-1, P5467A-2, SAT.sub.--084, SAT.sub.--275-DB, Satt660, Satt339, Satt358, Satt487, Satt420, Satt576, Satt633, Satt581, Satt153, Satt243, P10793A-1, P13560A-1, P13561A-1, Satt111, Satt219 and Satt299; wherein said set of chromosome segments comprises segments that comprise or are proximal to between about 10% and about 100% of said marker loci; thereby identifying a first soybean plant or germplasm with increased yield.

13. A method of identifying a first soybean plant or germplasm that displays increased yield, the method comprising: detecting in a genome of the first soybean plant or germplasm at least one allelic form of a set of chromosome segments, each segment in said set comprising a genetic element contributing to increased yield and each segment in said set comprising or proximal to a marker locus selected from the group of marker loci consisting of: Satt684, Satt526, Satt591, Satt385, Satt632-TB, Satt429, SAT-.sub.--261, P10641A-1, Satt556, P10638B-2, Satt190, SAT.sub.--311-DB, Satt338, Satt640-TB, Satt557, SAT.sub.--142-DB, Satt321, Satt203, Satt129, SAT.sub.--351, Satt701, Satt582, Satt389, Satt464, Satt672, Satt598, Satt343, Satt595, Satt334, Satt144, Satt522, Satt570, Satt356, Satt199, Sat.sub.--117, Satt279, Satt181, Satt127, Satt270, Satt292, Sat.sub.--065, Satt529, Satt242, Satt617, SAT.sub.--301, Satt398, Satt497, Satt166, Satt373, Satt680, P10615A-1, SAT.sub.--330-DB, P13069A-1, SAT.sub.--275-DB, Satt339, Satt487, Satt420, Satt581 and Satt153; wherein said set of chromosome segments comprises segments that comprise or are proximal to between about 10% and about 100% of said marker loci; thereby identifying a first soybean plant or germplasm with increased yield.

14. The method of claim 13, wherein the marker loci consist of: Satt684, Satt526, Satt591, Satt385, Satt632-TB, Satt429, SAT-.sub.--261, P10641A-1, Satt556, P10638B-2, Satt190, SAT.sub.--311-DB, Satt338, Satt640-TB, Satt557, SAT.sub.--142-DB, Satt321, Satt203, Satt129, SAT.sub.--351, Satt701, Satt582, Satt389, Satt464, Satt672, Satt598, Satt343, Satt595, Satt334, Satt144, Satt522, Satt570, Satt356, Satt199, Sat.sub.--117, Satt279, Satt181, Satt127, Satt270, Satt292, Sat.sub.--065, Satt529, Satt242, Satt617, SAT.sub.--301, Satt398, Satt497, Satt166, Satt373, Satt680, P10615A-1, SAT.sub.--330-DB, P13069A-1, SAT.sub.--275-DB, Satt339, Satt487, Satt420, Satt581 and Satt153.

15. A method of identifying a first soybean plant or germplasm that displays increased yield, the method comprising: detecting in a genome of the first soybean plant or germplasm at least one allelic form of a set of chromosome segments, each segment in said set comprising a genetic element contributing to increased yield and each segment in said set comprising or proximal to a marker locus selected from the group of marker loci consisting of: Satt526, Satt591, Satt429, SAT-.sub.--261, P10641A-1, Satt190, Satt557, SAT.sub.--142-DB, Satt129, SAT.sub.--351, Satt464, Satt343, Satt595, Satt570, Satt181, Satt127, Satt270, Sat.sub.--065, Satt529, Satt242, Satt398, Satt166, Satt373, Satt680, SAT.sub.--330-DB, P13069A-1, Satt339, Satt487, Satt581 and Satt153; wherein said set of chromosome segments comprises segments that comprise or are proximal to between about 10% and about 100% of said marker loci; thereby identifying a first soybean plant or germplasm with increased yield.

16. The method of claim 15, wherein the marker loci consist of: Satt526, Satt591, Satt429, SAT-.sub.--261, P10641A-1, Satt190, Satt557, SAT.sub.--142-DB, Satt129, SAT.sub.--351, Satt464, Satt343, Satt595, Satt570, Satt181, Satt127, Satt270, Sat.sub.--065, Satt529, Satt242, Satt398, Satt166, Satt373, Satt680, SAT.sub.--330-DB, P13069A-1, Satt339, Satt487, Satt581 and Satt153.

17. The method of claim 1, further comprising electronically transmitting or electronically storing data representing the determined allelic forms in a computer readable medium.

18. The method of claim 1, further comprising selecting the identified soybean plant.

19. The method of claim 18, wherein the selected soybean plant comprises a whole plant, a plant organ, a plant seed, a plant cell or a plant tissue culture.

20. The method of claim 18, wherein the selected soybean plant or a progeny thereof is crossed with a second soybean plant, which second soybean plant lacks the determined alleles of marker loci or the determined allelic forms of the plurality of chromosome segments.

21. The method of claim 20, wherein the second soybean plant comprises an elite strain of germplasm.

22. The method of claim 20, wherein the second soybean plant comprises exotic germplasm.

23. The method of claim 1, wherein the allelic form of each of a plurality of marker loci are determined in a first soybean plant genome and at least a second soybean plant genome, wherein the first soybean plant comprises a parent soybean plant and the at least second soybean plant comprises at least one progeny of the first soybean plant.

24. The method of claim 9, wherein the elite strain of germplasm is selected from the group consisting of: 90A07, 90B11, 90B31, 90B43, 90B72, 90B73, 91B01, 94B53, 94B54, 94B73, 95B32, 95B33, 95B34, 95B53, 95B95, 95B96, 95B97, 96B21, 96B51, 97B52, 97B61, BEDFORD, CX105, CX232, CX253, CX289, CX394C, CX469C, ESSEX, FORREST, HS93-4118, HUTCHESON, JIM, KORADA, PHARAOH, S0066, S0880, S1990, S19T9, S20F8, 525J5, S32Z3, S33N1, S38T8, S3911, S4260, S42H1, S43B5, S5960, S6262, ST0653, ST1073, ST1090, ST1570, ST1690, ST1970, ST2250, ST2488, ST2660, ST2686, ST2688, ST2788, ST2870, ST3171, ST3630, ST3660, ST3870, ST3883, TRACY, TRAILL, and YOUNG.
Description


FIELD OF THE INVENTION

The invention relates to the field of agricultural biotechnology and, more specifically, to molecular marker assisted selection and breeding of soybean plants.

BACKGROUND OF THE INVENTION

One of the most challenging aspects of plant breeding is to identify plant varieties that are superior to the currently available varieties used in commerce. Herein, the term "variety" and "genotype" will be used interchangeably since genetic differences are what make each variety unique and what make one variety superior to another in terms of commercial value.

For commodity crops like soybeans and corn, the most universal measure of commercial value is grain productivity per unit area or "yield". Since a farmer is paid according to the quantity (weight) of grain he delivers to an elevator, a farmer typically wants to plant a variety that produces the most grain per acre.

Although yield is arguably the most important trait that a plant breeder is concerned with, it is also the least understood genetically. There are many different plant traits that control the efficiency of converting nutrients and light into grain. Yield is therefore the final culmination of many different traits that contribute to productivity over the growing season. These would include seedling emergence vigor, photosynthetic ability, disease resistance, ability to mine nutrients from the soil, ability to produce flowers, and ability to shuttle photosynthate into grain, etc. The genetic bases of these individual traits that contribute to yield are largely unknown. Each trait that contributes to "yield" could be controlled by several or many genetic loci. Therefore, the overall genetic basis for yield is undoubtedly very complex. This is just one reason why traditional methods of determining the genetic basis of yield have not been very successful. To make incremental improvements in yield potential, for the most part, plant breeders are still using the same resource-intensive methods that have been in use for the last 80 or more years. Existing varieties are crossed to produce an array of new genotypes which are then exhaustively tested over many locations and replications in order to get enough yield data to differentiate the few consistently superior genotypes. This is one of the most expensive and time-consuming aspects of plant breeding.

During the 1990's, genetic markers linked to genes that contribute to yield emerged as a means to improve efficiency in certain aspects of the breeding process. These success stories have been limited to traits that are controlled by relatively few genes that are highly heritable. In this case, it is fairly routine to make a reliable association between a DNA sequence and a phenotype that can be confirmed with a greenhouse or field assay. However, until very recently, it has been extremely difficult to make reliable associations between specific DNA sequences and a very complex quantitative trait such as yield.

"Breeding bias," described in U.S. Pat. No. 5,437,697, which is incorporated herein in its entirety for all purposes, is a unique way to determine which genetic loci have been affected by extended periods of recurrent selection for yield. By comparing the genetic marker profiles of modern high yielding varieties to their most distant ancestors, breeding bias can quickly leverage an entire century of yield data to determine which specific alleles of which genetic markers have increased in frequency over time due to selection. Since increased yield has been the main criteria for selection, these markers are those most likely to be associated with yield progress over time. The present invention provides genetic markers that are associated with yield performance in a variety of geographic regions, as well as methods for utilizing these markers to efficiently identify soybean fines and sublines with increased yield.

SUMMARY OF THE INVENTION

The present invention provides representative markers that correspond to, and identify, chromosome segments important for superior agronomic performance in a variety of geographic regions and growing conditions. The markers described herein are shown to be associated with genetic elements contributing to increased yield in soybean. The markers, and methods for their use, described herein provide the means for defining and identifying soybean plants with improved yield relative to existing elite lines. Using the markers and methods described herein, identification of residual allelic variation among segregating lines of soybeans derived from elite strains can be used to increase the efficiency of the breeding program to develop novel sublines of soybean with increased yield relative to existing elite strains.

In a first aspect, the invention provides methods for identifying soybean sublines with increased yield relative to existing elite lines of soybeans. The methods of the invention involve detecting at least one allelic form of a plurality of chromosome segments, each of which a) includes a genetic element contributing to increased yield; and, b) includes or is proximal to a marker locus shown to be associated with increased yield in soybean.

For example, detecting an allelic form involves identifying at least one favorable allelic form of a chromosome segment, where the identified chromosome segment includes a genetic element contributing to increased yield and either includes or is proximal to (linked to) a marker selected from the specified set of markers which have been shown to be associated with yield. The favorable allelic form of a chromosome segment can be confirmed by identifying a polymorphic marker locus selected from the set, which is segregating in various sublines of progeny derived from a progenitor soybean. Yield is assessed in at least two sublimes of progeny with different allelic forms of the marker locus, and a subline of progeny with increased yield relative to the progenitor soybean is identified.

Exemplary marker loci shown by Breeding Bias analysis to be associated with genetic elements that contribute to increased yield in one or more geographic growing region are included in the following set of markers: Satt684, Satt165, Satt042, Satt364, Satt454, Satt526, Satt300, Satt591, Satt155, Satt385, Satt385, Satt225, Satt236, Satt511, P12390B-1, Satt480, Satt632-TB, Satt233, Satt327, Satt329, Satt508, P10635A-1, Satt409, Satt228, Satt429, Satt426, Satt509, SAT.sub.--261, Satt197, Satt519, Satt597, SCT.sub.--026, Satt415, Satt583, Satt430, P12198A-1, P8584A-1, Satt359, P10648A-1, P12105A-1, P10641A-1, Satt168, Satt556, Satt272, Satt020, Satt066, Satt534, P10638B-2, Satt399, Satt361, P10639A-1, Satt661-TB, Satt190, SAT.sub.--311-DB, Satt338, Satt227, Satt640-TB, Satt422, Satt457, Satt457, Satt557, Satt319, SAT.sub.--142-DB, Satt460, P13073A-1, Satt307, SCT.sub.--028, Satt433, Satt357, Satt321, Satt267, Satt383, Satt295, Satt203, Satt507, SAT.sub.--110, P10620A-1, Satt129, Satt147, Satt216, SAT.sub.--351, P10621B-2, Satt701, Satt634, Satt558, Satt266, Satt282, Satt537, Satt506, Satt546, P13072A-1, Satt582, Satt389, Satt461, Satt311, Satt514, Satt464, Satt662, Satt543, Satt186, Satt413, Satt672, P13074A-1, P10624A-1, Satt573, Satt598, Satt204, Satt263, Satt491, Satt602, Satt151, Satt355, Satt452, SAT.sub.--273-DB, Satt146, Satt193, Satt569, Satt343, Satt586, Satt040, Satt423, Satt348, Satt595, P10782A-1, P3436A-1, P10598A-1, Satt334, Satt510, Satt510, Satt144, Satt522, Satt522, P9026A-1, P10646A-1, P5219A-1, P7659A-2, Satt570, Satt356, Satt130, Satt115, Satt594, Satt533, Satt303, Satt352, Satt566, Satt199, Satt503, Satt517, Satt191, SAT.sub.--117, Satt353, Satt442, Satt279, Satt314, Satt142, Satt181, Satt367, Satt127, SCTT012, Satt270, Satt292, Satt440, P10640A-1, Satt249, SAG1223, SAC1699, SCT.sub.--065, Satt596, Satt280, Satt406, Satt380, Satt183, Satt529, Satt431, Satt242, Satt102, Satt441, Satt544, Satt617, Satt240, P10618A-1, Satt475, Satt196, SAT.sub.--301, Satt523, Satt418, Satt418, Satt398, Satt497, Satt284, Satt166, Satt448, Satt373, Satt513, P12394A-1, Satt590, Satt567, Satt220, SAG1048, Satt536, Satt175, Satt677, Satt680, P10615A-1, Satt551, Satt250, Satt346, Satt336, SAT.sub.--330-DB, P13069A-1, P5467A-1, P5467A-2, Satt584, SAT.sub.--084, P3050A-2, SAT.sub.--275-DB, Satt387, Satt549, Satt660, Satt339, Satt255, Satt257, Satt358, P12396A-1, Satt487, Satt259, Satt259, Satt347, Satt420, Satt576, Satt550, Satt633, Satt262, Satt473, Satt477, Satt581, P11070A-1, Satt153, Satt243, P8230A-1, P10623A-1, P10632A-1, P10793A-1, P12391A-1, P13560A-1, P13561A-1, P13561A-1, P2481A-1, S60021-TB, S60048-TB, S60076-TB, S60148-TB, S60149-TB, S60201-TB, S60243-TB, S60326-TB, S60338-TB, S60350-TB, S60361-TB, S60422-TB, S60440-TB, S60446-T13, S60505-TB, S60513-TB, S60519-TB, S60536-TB, S60552-TB, S60585-TB, S60630-TB, S60728-TB, S60812-TB, SAC1677, SAC1724, SAG1055, Satt040, Satt108, Satt109, Satt111, Satt176, Satt176, Satt219, Satt299, and Satt512. As such, marker loci of the set identify chromosome segments contributing to increased yield. Any number of additional marker loci linked to a marker locus selected from the set can be identified and will function as equivalents in the methods of the invention.

For example, in some embodiments the favorable allelic form of at least one chromosome segment, i.e., the allelic form associated with increased yield, is determined by a) identifying at least one polymorphic marker locus selected from the set in a plurality of sublines of progeny of a progenitor soybean, and b) assessing yield in at least two sublines of progeny having different allelic forms of the marker locus.

In other embodiments, the methods of identifying a soybean subline with increased yield involve detecting at least one allele of a marker locus segregating among progeny of a progenitor soybean. The marker locus includes at least two alleles, one of which correlates with increased yield whereas the other allele(s) does not correlate with increased yield. Increase in yield is measured relative to the mean yield of the progeny. Optionally, more than one marker locus is evaluated. The marker loci are selected from the set of loci consisting of Satt684, Satt165, Satt042, Satt364, Satt454, Satt526, Satt300, Satt591, Satt155, Satt385, Satt385, Satt225, Satt236, Satt511, P12390B-1, Satt480, Satt632-TB, Satt233, Satt327, Satt329, Satt508, P10635A-1, Satt409, Satt228, Satt429, Satt426, Satt509, SAT.sub.--261, Satt197, Satt519, Satt597, SCT.sub.--026, Satt415, Satt583, Satt430, P12198A-1, P8584A-1, Satt359, P10648A-1, P12105A-1, P10641A-1, Satt168, Satt556, Satt272, Satt020, Satt066, Satt534, P10638B-2, Satt399, Satt361, P10639A-1, Satt661-TB, Satt190, SAT.sub.--311-DB, Satt338, Satt227, Satt640-TB, Satt422, Satt457, Satt457, Satt557, Satt319, SAT.sub.--142-DB, Satt460, P13073A-1, Satt307, SCT.sub.--028, Satt433, Satt357, Satt321, Satt267, Satt383, Satt295, Satt203, Satt507, SAT.sub.--110, P10620A-1, Satt129, Satt147, Satt216, SAT.sub.--351, P10621B-2, Satt701, Satt634, Satt558, Satt266, Satt282, Satt537, Satt506, Satt546, P13072A-1, Satt582, Satt389, Satt461, Satt311, Satt514, Satt464, Satt662, Satt543, Satt186, Satt413, Satt672, P13074A-1, P10624A-1, Satt573, Satt598, Satt204, Satt263, Satt491, Satt602, Satt151, Satt355, Satt452, SAT.sub.--273-DB, Satt146, Satt193, Satt569, Satt343, Satt586, Satt040, Satt423, Satt348, Satt595, P10782A-1, P3436A-1, P10598A-1, Satt334, Satt510, Satt510, Satt144, Satt522, Satt522, P9026A-1, P10646A-1, P5219A-1, P7659A-2, Satt570, Satt356, Satt130, Satt115, Satt594, Satt533, Satt303, Satt352, Satt566, Satt199, Satt503, Satt517, Satt191, SAT.sub.--117, Satt353, Satt442, Satt279, Satt314, Satt142, Satt181, Satt367, Satt127, SCTT012, Satt270, Satt292, Satt440, P10640A-1, Satt249, SAG1223, SAC1699, SCT.sub.--065, Satt596, Satt280, Satt406, Satt380, Satt183, Satt529, Satt431, Satt242, Satt102, Satt441, Satt544, Satt617, Satt240, P10618A-1, Satt475, Satt196, SAT.sub.--301, Satt523, Satt418, Satt418, Satt398, Satt497, Satt284, Satt166, Satt448, Satt373, Satt513, P12394A-1, Satt590, Satt567, Satt220, SAG1048, Satt536, Satt175, Satt677, Satt680, P10615A-1, Satt551, Satt250, Satt346, Satt336, SAT.sub.--330-DB, P13069A-1, P5467A-1, P5467A-2, Satt584, SAT.sub.--084, P3050A-2, SAT.sub.--275-DB, Satt387, Satt549, Satt660, Satt339, Satt255, Satt257, Satt358, P12396A-1, Satt487, Satt259, Satt259, Satt347, Satt420, Satt576, Satt550, Satt633, Satt262, Satt473, Satt477, Satt581, P11070A-1, Satt153, Satt243, P8230A-1, P10623A-1, P10632A-1, P10793A-1, P12391A-1, P13560A-1, P13561A-1, P13561A-1, P2481A-1, S60021-TB, S60048-TB, S60076-TB, S60148-TB, S60149-TB, S60201-TB, S60243-TB, S60326-TB, S60338-TB, S60350-TB, S60361-TB, S60422-TB, S60440-TB, S60446-TB, S60505-TB, S60513-TB, S60519-TB, S60536-TB, S60552-TB, S60585-TB, S60630-TB, S60728-TB, S60812-TB, SAC1677, SAC1724, SAG1055, Satt040, Satt108, Satt109, Satt111, Satt176, Satt176, Satt219, Satt299, and Satt512.

In some embodiments, the allelic form of between about 10% and about 100% of chromosome segments in the set, or in a specified subset of the markers relevant in a particular geographic region, as enumerated in Tables 3 through 12, are detected. Usually the allelic form of between about 10% and about 90% of the chromosome segments relevant in a particular geographic region are determined. Commonly, a majority of the allelic forms are determined. In an embodiment, the allelic forms of essentially all of the chromosome segments are determined.

For example, in a breeding program aimed at developing soybeans with increased yield in the central growing region (e.g., Iowa) allelic forms of between about 10% and about 100% of the chromosome segments including or proximal to the markers from the set including Satt642, Satt042, Satt364, Satt454, Satt526, Satt300, Satt591, Satt155, Satt385, Satt511, P12390B-1, Satt632-TB, Satt429, SAT.sub.--261, Satt197, P10641A-1, Satt556, Satt534, P10638B-2, Satt399. Satt361, P10639A-1, Satt661-TB, Satt190, SAT.sub.--311-DB, Satt338, Satt640-TB, Satt557, Satt319, SAT.sub.--142-DB, Satt460, Satt433, Satt357, Satt321, Satt295, Satt203, Satt507, Satt129, Satt147, SAT.sub.--351, P10621B-2, Satt558, Satt701, Satt634, Satt582, Satt389, Satt464, Satt662, Satt672, Satt573, Satt598, Satt263, Satt602, Satt151, SAT.sub.--273-DB, Satt146, Satt193, Satt569, Satt176, Satt343, Satt586, Satt040, Satt595, P10782A-1, Satt334, Satt144, Satt522, Satt570, Satt356, Satt533, Satt199, Satt517, Satt191, SAT.sub.--117, Satt279, Satt181, Satt127, Satt270, Satt292, SAG1223, SAC1699, SAT.sub.--065, Satt596, Satt406, Satt380, Satt183, Satt529, Satt242, Satt617, Satt240, SAT.sub.--301, Satt418, Satt398, Satt497, Satt166, Satt448, Satt373, Satt513, P12394A-1, SAG1048, Satt536, Satt175, Satt677, Satt680, P10615A-1, Satt551, Satt346, Satt336, SAT.sub.--330-DB, P13069A-1, P5467A-1, P5467A-2, SAT.sub.--084, SAT.sub.--275-DB, Satt660, Satt339, P12396A-1, Satt358, Satt487, Satt259, Satt420, Satt576, Satt633, Satt477, Satt581, Satt153, Satt243, P10793A-1, P12391A-1, P12392A-1, P13560A-1, P13561A-1, S60021-TB, S60048-TB, S60076-TB, S60148-TB, S60149-TB, S60201-TB, S60243-TB, S60326-TB, S60338-TB, S60350-TB, S60361-TB, S60422-TB, S60440-TB, S60446-TB, S60505-TB, S60513-TB, S60519-TB, S60536-TB, S60552-TB, S60585-TB, S60630-TB, S60728-TB, S60812-TB, SAC1677, SAC1724, SAG1055, Satt040, Satt111, Satt176, Satt219 and Satt299 are determined. In an embodiment, the set of markers includes Satt684, Satt042, Satt364, Satt454, Satt526, Satt300, Satt591, Satt155, Satt385, Satt632-TB, Satt429, SAT-.sub.--261, P10641A-1, Satt556, P10638B-2, Satt399, Satt361, Satt661-TB, Satt190, SAT.sub.--311-DB, Satt338, Satt640-TB, Satt557, Satt319, SAT.sub.--142-DB, Satt321, Satt203, Satt129, Satt147, SAT.sub.--351, P10621B-2, Satt701, Satt634, Satt582, Satt389, Satt464, Satt662, Satt672, Satt573, Satt598, Satt263, Satt151, SAT.sub.--273-DB, Satt146, Satt193, Satt569, Satt343, Satt586, Satt040, Satt595, Satt334, Satt144, Satt522, Satt570, Satt356, Satt199, Satt517, Satt191, Sat 117, Satt279, Satt181, Satt127, Satt270, Satt292, SAG1223, SAC1699, Sat 065, Satt596, Satt406, Satt380, Satt183, Satt529, Satt242, Satt617, Satt240, SAT.sub.--301, Satt418, Satt398, Satt497, Satt166, Satt448, Satt373, Satt513, P12394A-1, SAG1048, Satt536, Satt175, Satt677, Satt680, P10615A-1, Satt551, SAT.sub.--330-DB, P13069A-1, P5467A-1, P5467A-2, SAT.sub.--084, SAT.sub.--275-DB, Satt660, Satt339, Satt358, Satt487, Satt487, Satt420, Satt576, Satt633, Satt581, Satt153, Satt243, P10793A-1, P13560A-1, P13561A-1, S60021-TB, S60048-TB, S60076-TB, S60148-TB, S60149-TB, S60201-TB, S60243-TB, S60326-TB, S60338-TB, S60350-TB, S60361-TB, S60422-TB, S60440-TB, S60446-TB, S60505-TB, S60513-TB, S60519-TB, S60536-TB, S60552-TB, S60585-TB, S60630-TB, S60728-TB, S60812-TB, SAC1677, SAC1724, SAG1055, Satt111, Satt219 and Satt299 are determined. In an embodiment, the set of markers includes Satt684, Satt526, Satt591, Satt385, Satt632-TB, Satt429, SAT-261, P10641A-1, Satt556, P106388-2, Satt190, SAT.sub.--311-DB, Satt338, Satt640-TB, Satt557, SAT.sub.--142-DB, Satt321, Satt203, Satt129, SAT.sub.--351, Satt701, Satt582, Satt389, Satt464, Satt672, Satt598, Satt343, Satt595, Satt334, Satt144, Satt522, Satt570, Satt356, Satt199, Sat 117, Satt279, Satt181, Satt127, Satt270, Satt292, SAG1223, Sat.sub.--065, Satt529, Satt242, Satt617, SAT.sub.--301, Satt398, Satt497, Satt166, Satt373, SAG1048, Satt680, P10615A-1, SAT.sub.--330-DB, P13069A-1, SAT.sub.--275-DB, Satt339, Satt487, Satt420, Satt581 and Satt153.

In other embodiments, the methods of identifying a soybean subline with increased yield involve detecting at least one allele of a marker locus segregating among progeny of a progenitor soybean. The marker locus includes at least two alleles, one of which correlates with increased yield whereas the other allele(s) does not correlate with increased yield. Increase in yield is measured relative to the mean yield of the progeny. Optionally, more than one marker locus is evaluated. The marker loci are selected from the set of loci consisting of: Satt684, Satt165, Satt042, Satt364, Satt454, Satt526, Satt300, Satt591, Satt155, Satt385, Satt385, Satt225, Satt236, Satt511, P12390B-1, Satt480, Satt632-TB, Satt233, Satt327, Satt329, Satt508, P10635A-1, Satt409, Satt228, Satt429, Satt426, Satt509, SAT.sub.--261, Satt197, Satt519, Satt597, SCT.sub.--026, Satt415, Satt583, Satt430, P12198A-1, P8584A-1, Satt359, P10648A-1, P12105A-1, P10641A-1, Satt168, Satt556, Satt272, Satt020, Satt066, Satt534, P10638B-2, Satt399, Satt361, P10639A-1, Satt661-TB, Satt190, SAT.sub.--311-DB, Satt338, Satt227, Satt640-TB, Satt422, Satt457, Satt457, Satt557, Satt319, SAT.sub.--142-DB, Satt460, P13073A-1, Satt307, SCT.sub.--028, Satt433, Satt357, Satt321, Satt267, Satt383, Satt295, Satt203, Satt507, SAT.sub.--110, P10620A-1, Satt129, Satt147, Satt216, SAT.sub.--351, P10621B-2, Satt701, Satt634, Satt558, Satt266, Satt282, Satt537, Satt506, Satt546, P13072A-1, Satt582, Satt389, Satt461, Satt311, Satt514, Satt464, Satt662, Satt543, Satt186, Satt413, Satt672, P13074A-1, P10624A-1, Satt573, Satt598, Satt204, Satt263, Satt491, Satt602, Satt151, Satt355, Satt452, SAT.sub.--273-DB, Satt146, Satt193, Satt569, Satt343, Satt586, Satt040, Satt423, Satt348, Satt595, P10782A-1, P3436A-1, P10598A-1, Satt334, Satt510, Satt510, Satt144, Satt522, Satt522, P9026A-1, P10646A-1, P5219A-1, P7659A-2, Satt570, Satt356, Satt130, Satt115, Satt594, Satt533, Satt303, Satt352, Satt566, Satt199, Satt503, Satt517, Satt191, SAT.sub.--117, Satt353, Satt442, Satt279, Satt314, Satt142, Satt181, Satt367, Satt127, SCTT012, Satt270, Satt292, Satt440, P10640A-1, Satt249, SAG1223, SAC1699, SCT.sub.--065, Satt596, Satt280, Satt406, Satt380, Satt183, Satt529, Satt431, Satt242, Satt102, Satt441, Satt544, Satt617, Satt240, P10618A-1, Satt475, Satt196, SAT.sub.--301, Satt523, Satt418, Satt418, Satt398, Satt497, Satt284, Satt166, Satt448, Satt373, Satt513, P12394A-1, Satt590, Satt567, Satt220, SAG1048, Satt536, Satt175, Satt677, Satt680, P10615A-1, Satt551, Satt250, Satt346, Satt336, SAT.sub.--330-DB, P13069A-1, P5467A-1, P5467A-2, Satt584, SAT.sub.--084, P3050A-2, SAT.sub.--275-DB, Satt387, Satt549, Satt660, Satt339, Satt255, Satt257, Satt358, P12396A-1, Satt487, Satt259, Satt259, Satt347, Satt420, Satt576, Satt550, Satt633, Satt262, Satt473, Satt477, Satt581, P11070A-1, Satt153, Satt243, P8230A-1, P10623A-1, P10632A-I, P10793A-1, P12391A-1, P13560A-1, P13561A-1, P13561A-1, P2481A-1, S60021-TB, S60048-TB, S60076-TB, S60148-TB, S60149-TB, S60201-TB, S60243-TB, S60326-TB, S60338-TB, S60350-TB, S60361-TB, S60422-TB, S60440-TB, S60446-TB, S60505-TB, S60513-TB, S60519-TB, S60536-TB, S60552-TB, S60585-TB, S60630-TB, S60728-TB, S60812-TB, SAC1677, SAC1724, SAG1055, Satt040, Satt108, Satt109, Satt111, Satt176, Satt176, Satt219, Satt299, and Satt512.

In some embodiments, at least one allele of between about 10% and about 100% of the markers in the set, or in a specified subset of the markers relevant in a particular geographic region, as enumerated in Tables 3 through 12, are detected. Usually at least one allele of between about 10% and about 90% of the marker loci relevant in a particular geographic region are determined. Commonly, a majority of the marker loci are evaluated. In an embodiment, essentially all of the marker loci are evaluated.

For example, in a breeding program aimed at developing soybeans with increased yield in the central growing region (e.g., Iowa) at least one allele of between about 10% and about 100% of the marker loci from the set including Satt642, Satt042, Satt364, Satt454, Satt526, Satt300, Satt591, Satt155, Satt385, Satt511, P12390B-1, Satt632-TB, Satt429, SAT.sub.--261, Satt197, P10641A-1, Satt556, Satt534, P10638B-2, Satt399. Satt361, P10639A-1, Satt661-TB, Satt190, SAT.sub.--311-DB, Satt338, Satt640-TB, Satt557, Satt319, SAT.sub.--142-DB, Satt460, Satt433, Satt357, Satt321, Satt295, Satt203, Satt507, Satt129, Satt147, SAT.sub.--351, P10621B-2, Satt558, Satt701, Satt634, Satt582, Satt389, Satt464, Satt662, Satt672, Satt573, Satt598, Satt263, Satt602, Satt151, SAT.sub.--273-DB, Satt146, Satt193, Satt569, Satt176, Satt343, Satt586, Satt040, Satt595, P10782A-1, Satt334, Satt144, Satt522, Satt570, Satt356, Satt533, Satt199, Satt517, Satt191, SAT.sub.--117, Satt279, Satt181, Satt127, Satt270, Satt292, SAG1223, SAC1699, SAT.sub.--065, Satt596, Satt406, Satt380, Satt183, Satt529, Satt242, Satt617, Satt240, SAT.sub.--301, Satt418, Satt398, Satt497, Satt166, Satt448, Satt373, Satt513, P12394A-1, SAG1048, Satt536, Satt175, Satt677, Satt680, P10615A-1, Satt551, Satt346, Satt336, SAT.sub.--330-DB, P13069A-1, P5467A-1, P5467A-2, SAT.sub.--084, SAT.sub.--275-DB, Satt660, Satt339, P12396A-1, Satt358, Satt487, Satt259, Satt420, Satt576, Satt633, Satt477, Satt581, Satt153, Satt243, P10793A-1, P12391A-1, P12392A-1, P13560A-1, P13561A-1, S60021-TB, S60048-TB, S60076-TB, S60148-TB, S60149-TB, S60201-TB, S60243-TB, S60326-TB, S60338-TB, S60350-TB, S60361-TB, S60422-TB, S60440-TB, S60446-TB, S60505-TB, S60513-TB, S60519-TB, S60536-TB, S60552-TB, S60585-TB, S60630-TB, S60728-TB, S60812-TB, SAC1677, SAC1724, SAG1055, Satt040, Satt111, Satt176, Satt219 and Satt299 are determined. In an embodiment, the set of markers includes Satt684, Satt042, Satt364, Satt454, Satt526, Satt300, Satt591, Satt155, Satt385, Satt632-TB, Satt429, SAT-261, P10641A-1, Satt556, P10638B-2, Satt399, Satt361, Satt661-TB, Satt190, SAT.sub.--311-DB, Satt338, Satt640-TB, Satt557, Satt319, SAT.sub.--142-DB, Satt321, Satt203, Satt129, Satt147, SAT.sub.--351, P10621B-2, Satt701, Satt634, Satt582, Satt389, Satt464, Satt662, Satt672, Satt573, Satt598, Satt263, Satt151, SAT.sub.--273-DB, Satt146, Satt193, Satt569, Satt343, Satt586, Satt040, Satt595, Satt334, Satt144, Satt522, Satt570, Satt356, Satt199, Satt517, Satt191, Sat 117, Satt279, Satt181, Satt127, Satt270, Satt292, SAG1223, SAC1699, Sat.sub.--065, Satt596, Satt406, Satt380, Satt183, Satt529, Satt242, Satt617, Satt240, SAT.sub.--301, Satt418, Satt398, Satt497, Satt166, Satt448, Satt373, Satt513, P12394A-1, SAG1048, Satt536, Satt175, Satt677, Satt680, P10615A-1, Satt551, SAT.sub.--330-DB, P13069A-1, P5467A-1, P5467A-2, SAT.sub.--084, SAT.sub.--275-DB, Satt660, Satt339, Satt358, Satt487, Satt487, Satt420, Satt576, Satt633, Satt581, Satt153, Satt243, P10793A-1, P13560A-1, P13561A-1, S60021-TB, S60048-TB, S60076-TB, S60148-TB, S60149-TB, S60201-TB, S60243-TB, S60326-TB, S60338-TB, S60350-TB, S60361-TB, S60422-TB, S60440-TB, S60446-TB, S60505-TB, S60513-TB, S60519-TB, S60536-TB, S60552-TB, S60585-TB, S60630-TB, S60728-TB, S60812-TB, SAC1677, SAC1724, SAG1055, Satt111, Satt219 and Satt299 are determined. In an embodiment, the set of markers includes Satt684, Satt526, Satt591, Satt385, Satt632-TB, Satt429, SAT-261, P10641A-1, Satt556, P10638B-2, Satt190, SAT.sub.--311-DB, Satt338, Satt640-TB, Satt557, SAT.sub.--142-DB, Satt321, Satt203, Satt129, SAT.sub.--351, Satt701, Satt582, Satt389, Satt464, Satt672, Satt598, Satt343, Satt595, Satt334, Satt144, Satt522, Satt570, Satt356, Satt199, Sat.sub.--117, Satt279, Satt181, Satt127, Satt270, Satt292, SAG1223, Sat 065, Satt529, Satt242, Satt617, SAT.sub.--301, Satt398, Satt497, Satt166, Satt373, SAG1048, Satt680, P10615A-1, SAT.sub.--330-DB, P13069A-1, SAT.sub.--275-DB, Satt339, Satt487, Satt420, Satt581 and Satt153.

In some embodiments, the allele correlated with increased yield, and conversely, the allele not correlated with increased yield, are determined as follows. At least one polymorphic marker locus having at least two segregating alleles in a plurality of sublines of progeny soybean plants is selected. The yield is assessed in at least two sublines of progeny with different alleles of the marker. A subline with increased yield relative to the mean yield of the sublimes is then identified confirming a correlation between one of the segregating alleles and increased yield.

ed yield, and conversely, the allele not correlated with increased yield, are determined as follows. At least one polymorphic marker locus having at least two segregating alleles in a plurality of sublines of progeny soybean plants is selected. The yield is assessed in at least two sublines of progeny with different alleles of the marker. A subline with increased yield relative to the mean yield of the sublines is then identified confirming a correlation between one of the segregating alleles and increased yield.

The methods for identifying soybean sublines with increased yield involve detecting at least one allelic form of multiple marker loci. Typically, the number of marker loci is greater than two, and typically is between 10% and 100% of the set of marker loci including: Satt684, Satt165, Satt042, Satt364, Satt454, Satt526, Satt300, Satt591, Satt155, Satt385, Satt385, Satt225, Satt236, Satt511, P12390B-1, Satt480, Satt632-TB, Satt233, Satt327, Satt329, Satt508, P10635A-1, Satt409, Satt228, Satt429, Satt426, Satt509, SAT.sub.--261, Satt197, Satt519, Satt597, SCT.sub.--026, Satt415, Satt583, Satt430, P12198A-1, P8584A-1, Satt359, P10648A-1, P12105A-1, P10641A-1, Satt168, Satt556, Satt272, Satt020, Satt066, Satt534, P10638B-2, Satt399, Satt361, P10639A-1, Satt661-TB, Satt190, SAT.sub.--311-DB, Satt338, Satt227, Satt640-TB, Satt422, Satt457, Satt457, Satt557, Satt319, SAT.sub.--142-DB, Satt460, P13073A-1, Satt307, SCT.sub.--028, Satt433, Satt357, Satt321, Satt267, Satt383, Satt295, Satt203, Satt507, SAT.sub.--11.0, P10620A-1, Satt129, Satt147, Satt216, SAT.sub.--351, P10621B-2, Satt701, Satt634, Satt558, Satt266, Satt282, Satt537, Satt506, Satt546, P13072A-1, Satt582, Satt389, Satt461, Satt311, Satt514, Satt464, Satt662, Satt543, Satt186, Satt413, Satt672, P13074A-1, P10624A-1, Satt573, Satt598, Satt204, Satt263, Satt491, Satt602, Satt151, Satt355, Satt452, SAT.sub.--273-DB, Satt146, Satt193, Satt569, Satt343, Satt586, Satt040, Satt423, Satt348, Satt595, P10782A-1, P3436A-1, P10598A-1, Satt334, Satt510, Satt510, Satt144, Satt522, Satt522, P9026A-1, P10646A-1, P5219A-1, P7659A-2, Satt570, Satt356, Satt130, Satt115, Satt594, Satt533, Satt303, Satt352, Satt566, Satt199, Satt503, Satt517, Satt191, SAT.sub.--117, Satt353, Satt442, Satt279, Satt314, Satt142, Satt181, Satt367, Satt127, SCTT012, Satt270, Satt292, Satt440, P10640A-1, Satt249, SAG1223, SAC1699, SCT.sub.--065, Satt596, Satt280, Satt406, Satt380, Satt183, Satt529, Satt431, Satt242, Satt102, Satt441, Satt544, Satt617, Satt240, P10618A-1, Satt475, Satt196, SAT.sub.--301, Satt523, Satt418, Satt418, Satt398, Satt497, Satt284, Satt166, Satt448, Satt373, Satt513, P12394A-1, Satt590, Satt567, Satt220, SAG1048, Satt536, Satt175, Satt677, Satt680, P10615A-1, Satt551, Satt250, Satt346, Satt336, SAT.sub.--330-DB, P13069A-1, P5467A-1, P5467A-2, Satt584, SAT.sub.--084, P3050A-2, SAT.sub.--275-DB, Satt387, Satt549, Satt660, Satt339, Satt255, Satt257, Satt358, P12396A-1, Satt487, Satt259, Satt259, Satt347, Satt420, Satt576, Satt550, Satt633, Satt262, Satt473, Satt477, Satt581, P11070A-1, Satt153, Satt243, P8230A-1, P10623A-1, P10632A-1, P10793A-1, P12391A-1, P13560A-1, P13561A-1, P13561A-1, P2481A-1, S60021-TB, S60048-TB, S60076-TB, S60148-TB, S60149-TB, S60201-TB, S60243-TB, S60326-TB, S60338-TB, S60350-TB, S60361-TB, S60422-TB, S60440-TB, S60446-TB, S60505-TB, S60513-TB, S60519-TB, S60536-TB, S60552-TB, S60585-TB, S60630-TB, S60728-TB, S60812-TB, SAC1677, SAC1724, SAG1055, Satt040, Satt108, Satt109, Satt111, Satt176, Satt176, Satt219, Satt299, and Satt512, or a geographically relevant subset thereof as indicated in Tables 3 through 12. Usually, the methods involve detecting between about 10% and about 90% of the markers in the set. Frequently, at least 50% of the markers are detected, i.e., a majority of the markers in the set. In some instances essentially all of the markers are detected. Each of the detected marker loci identifies a chromosome segment shown to include a genetic element which contributes to increased yield in at least one geographic growing region. Thus, by identifying alleles of the markers associated with increased yield, sublines of soybeans with increased yield are identified.

The population of progeny soybeans utilized can be obtained by crossing a first progenitor soybean with a second progenitor soybean. Alternatively, the population of progeny can be obtained by selling a single progenitor soybean. In some embodiments, the sublines of progeny evaluated include random sublines. In some embodiments, the sublines include near isogenic sublines.

Typically, the progenitor soybean is selected from an elite strain of germplasm. Such a progenitor can be self-fertilized to generate progeny. More commonly, in the methods of the invention, the progenitor soybean is crossed to a second soybean selected from a different elite strain of germplasm. Alternatively, the progenitor soybean can be crossed to a soybean with an exotic strain of germplasm.

The elite strain of germplasm is typically selected from among the following strains of germplasm: 90A07, 90B11, 90B31, 90B43, 90B72, 90B73, 91B01, 91B12, 91B33, 91B52, 91B53, 91B64, 91B91, 91B92, 92B05, 92B12, 92B23, 92B38, 92B52, 92B63, 92B74, 92B75, 92B84, 92B95, 92M30, 92M31, 92M70, 92M71, 92M72, 92M80, 92M91, 93B01, 93B09, 93B11, 93B15, 93B25, 93B26, 93B36, 93B41, 93B45, 93B46, 93B66, 93B67, 93B68, 93B72, 93B82, 93B84, 93B85, 93B86, 93B87, 93M10, 93M30, 93M40, 93M50, 93M60, 93M80, 93M90, 93M92, 93M93, 94B01, 94B23, 94B24, 94B53, 94B54, 94B73, 95B32, 95B33, 95B34, 95B53, 95B95, 95B96, 95B97, 96B21, 96B51, 97B52, 97B61, A1395, A2722, A2835, A2943, A3127, A3237, A3242, A3322, A3431, A4009, A4138, A4415, A4595, A4715, A5403, A5560, A5843, A5885, A5979, A5980, A6297, BEDFORD, CM428, CX105, CX232, CX253, CX289, CX394C, CX469C, D00566D362, ESSEX, EX04C00, EX06A00, EX10F01, EX13P01, EX13Q01, EX15N01, EX16N00, EX16P01, EX22Y01, EX22Z01, EX23B03, EX34T03, EX35F03, EX36Y01, EX39E00, EX40T03, EX44V03, FORREST, G3362, HS93-4118, HUTCHESON, JIM, KORADA, MO15733, M0400644-02, M0413735-11-52, M0501577-27-23, M0505469-61-89, MP39009, P1677, P9007, P9008, P9041, P9042, P9061, P9062, P9063, P9071, P9092, P9132, P9141, P9151, P9163, P9182, P9203, P9233, P9244, P9273, P9281, P9305, P9306, P9321, P9341, P9392, P9395, P9481, P9482, P9492, P9521, P9552, P9561, P9584, P9591, P9592, P9594, P9631, P9641, PHARAOH, RA451, R01154R002, S0066, S03W4, S0880, S1550, S1990, S19T9, S20F8, S22C3, S24L2, S25J5, S32Z3, S33N1, S38T8, S3911, S4260, S42H1, S43B5, S5960, S6189, S6262, ST0653, ST1073, ST1090, ST1570, ST1690, ST1970, ST2250, ST2488, ST2660, ST2686, ST2688, ST2788, ST2870, ST3171, ST3380, ST3630, ST3660, ST3870, ST3883, TRACY, TRAILL, X9916, YB03E00, XB03F01, XB07E01, XB10D01, XB15M01, XB19U04, XB20M01, XB22C04, XB22R01, XB23W03, XB23Y02, XB25E02, XB25L04, XB25.times.04, XB25W01, XB26L04, XB27P04, XB29A04, XB29D01, XB29K04, XB29L04, XB30E04, XB31C01, XB31R04, XB33B, XB34D04, XB34F01, XB35D, XB35L04, XB35W00, XB38A01, XB41M01, XB42J00, XB42M01, XB48H01, XB54K01, XB55J01, XB58P99, XB63D00, XB67A00, YB03G01, YB08D01, YB09F01, YB09G01, YB10E01, YB11D01, YB14H01, YB15K99, YB21F01, YB21G01, YB22S00, YB22V01, YB22W01, YB22.times.01, YB24Z01, YB25R03, YB25R99, YB25X00, YB25Y01, YB25Z01, YB27L03, YB27S00, YB27.times.01, YB27Y01, YB28A03, YB28N01, YB29H01, YB29J01, YB29T04, YB30J01, YB30N01, YB30P01, YB31E01, YB32K01, YB33K01, YB34H01, YB34R03, YB34S03, YB35C01, YB36E03, YB36V00, YB38E03, YB38G03, YB39M01, YB39V03, YB40M01, YB40N01, YB41Q01, YB48L01, YB52J00, YB53E00, YB54H00, YB54J00, YB54L00, YB55H00, YB56E00, YB60N01, and YOUNG.

In some embodiments, the methods include electronically transmitting or electronically storing data representing the determined marker alleles or allelic forms or chromosome segments in a computer readable medium. Accordingly, another aspect of the invention includes computer systems including a data input device for inputting genotyping data, and a computer readable medium incorporating the genotyping data corresponding to the markers of the invention. Computer readable medium including the genotyping data are also a feature of the invention.

In some embodiments, the methods further include selecting at least one plant of the identified soybean subline. The selected plant can be a whole plant, a plant organ, a plant seed, a plant cell, a plant tissue culture, or the like. Optionally, the selected soybean plant, or a progeny thereof is crossed with a second soybean plant. Typically the second soybean plant lacks the determined allele of the marker locus (or allelic form of the chromosome segment).

In some embodiments, the second soybean plant is from an elite strain of germplasm. In other embodiments, the second soybean plant is from an exotic strain of germplasm.

Soybean plants with increased yield produced according to the methods of the invention are also a feature of the invention.

In another aspect, the invention includes sets of markers useful for identifying soybean plants with increased yield. The marker sets include markers selected from the set of markers including Satt684, Satt165, Satt042, Satt364, Satt454, Satt526, Satt300, Satt591, Satt155, Satt385, Satt385, Satt225, Satt236, Satt511, P12390B-1, Satt480, Satt632-TB, Satt233, Satt327, Satt329, Satt508, P10635A-1, Satt409, Satt228, Satt429, Satt426, Satt509, SAT.sub.--261, Satt197, Satt519, Satt597, SCT.sub.--026, Satt415, Satt583, Satt430, P12198A-1, P8584A-1, Satt359, P10648A-1, P12105A-1, P10641A-1, Satt168, Satt556, Satt272, Satt020, Satt066, Satt534, P10638B-2, Satt399, Satt361, P10639A-1, Satt661-TB, Satt190, SAT.sub.--311-DB, Satt338, Satt227, Satt640-TB, Satt422, Satt457, Satt457, Satt557, Satt319, SAT.sub.--142-DB, Satt460, P13073A-1, Satt307, SCT.sub.--028, Satt433, Satt357, Satt321, Satt267, Satt383, Satt295, Satt203, Satt507, SAT.sub.--110, P10620A-1, Satt129, Satt147, Satt216, SAT.sub.--351, P10621B-2, Satt701, Satt634, Satt558, Satt266, Satt282, Satt537, Satt506, Satt546, P13072A-1, Satt582, Satt389, Satt461, Satt311, Satt514, Satt464, Satt662, Satt543, Satt186, Satt413, Satt672, P13074A-1, P10624A-1, Satt573, Satt598, Satt204, Satt263, Satt491, Satt602, Satt151, Satt355, Satt452, SAT.sub.--273-DB, Satt146, Satt193, Satt569, Satt343, Satt586, Satt040, Satt423, Satt348, Satt595, P10782A-1, P3436A-1, P10598A-1, Satt334, Satt510, Satt510, Satt144, Satt522, Satt522, P9026A-1, P10646A-1, P5219A-1, P7659A-2, Satt570, Satt356, Satt130, Satt115, Satt594, Satt533, Satt303, Satt352, Satt566, Satt199, Satt503, Satt517, Satt191, SAT.sub.--117, Satt353, Satt442, Satt279, Satt314, Satt142, Satt181, Satt367, Satt127, SCTT012, Satt270, Satt292, Satt440, P10640A-1, Satt249, SAG1223, SAC1699, SCT.sub.--065, Satt596, Satt280, Satt406, Satt380, Satt183, Satt529, Satt431, Satt242, Satt102, Satt441, Satt544, Satt617, Satt240, P10618A-1, Satt475, Satt196, SAT.sub.--301, Satt523, Satt418, Satt418, Satt398, Satt497, Satt284, Satt166, Satt448, Satt373, Satt513, P12394A-1, Satt590, Satt567, Satt220, SAG1048, Satt536, Satt175, Satt677, Satt680, P10615A-1, Satt551, Satt250, Satt346, Satt336, SAT.sub.--330-DB, P13069A-1, P5467A-1, P5467A-2, Satt584, SAT.sub.--084, P3050A-2, SAT.sub.--275-DB, Satt387, Satt549, Satt660, Satt339, Satt255, Satt257, Satt358, P12396A-1, Satt487, Satt259, Satt259, Satt347, Satt420, Satt576, Satt550, Satt633, Satt262, Satt473, Satt477, Satt581, P11070A-1, Satt153, Satt243, P8230A-1, P10623A-1, P10632A-1, P10793A-1, P12391A-1, P13560A-1, P13561A-1, P13561A-1, P2481A-1, S60021-TB, S60048-TB, S60076-T13, S60148-TB, S60149-TB, S60201-TB, S60243-TB, S60326-TB, S60338-TB, S60350-TB, S60361-TB, S60422-TB, S60440-TB, S60446-TB, S60505-TB, S60513-TB, S60519-TB, S60536-TB, S60552-TB, S60585-TB, S60630-TB, S60728-TB, S60812-TB, SAC1677, SAC1724, SAG1055, Satt040, Satt108, Satt109, Satt111, Satt176, Satt176, Satt219, Satt299, and Satt512. Typically a subset of markers shown to be relevant in a geographic growing region is selected, as indicated in Tables 3 through 12. For example, in a breeding program designed to develop strains of soybean with increased yield in the Central (e.g., Iowa) region, a set of markers selected from among the following marker set is preferred: Satt642, Satt042, Satt364, Satt454, Satt526, Satt300, Satt591, Satt155, Satt385, Satt511, P12390B-1, Satt632-TB, Satt429, SAT.sub.--261, Satt197, P10641A-1, Satt556, Satt534, P106388-2, Satt399. Satt361, P10639A-1, Satt661-TB, Satt190, SAT.sub.--311-DB, Satt338, Satt640-TB, Satt557, Satt319, SAT.sub.--142-DB, Satt460, Satt433, Satt357, Satt321, Satt295, Satt203, Satt507, Satt129, Satt147, SAT.sub.--351, P10621B-2, Satt558, Satt701, Satt634, Satt582, Satt389, Satt464, Satt662, Satt672, Satt573, Satt598, Satt263, Satt602, Satt151, SAT.sub.--273-DB, Satt146, Satt193, Satt569, Satt176, Satt343, Satt586, Satt040, Satt595, P10782A-1, Satt334, Satt144, Satt522, Satt570, Satt356, Satt533, Satt199, Satt517, Satt191, SAT.sub.--117, Satt279, Satt181, Satt127, Satt270, Satt292, SAG1223, SAC1699, SAT.sub.--065, Satt596, Satt406, Satt380, Satt183, Satt529, Satt242, Satt617, Satt240, SAT.sub.--301, Satt418, Satt398, Satt497, Satt166, Satt448, Satt373, Satt513, P12394A-1, SAG1048, Satt536, Satt175, Satt677, Satt680, P10615A-1, Satt551, Satt346, Satt336, SAT.sub.--330-DB, P13069A-1, P5467A-1, P5467A-2, SAT.sub.--084, SAT.sub.--275-DB, Satt660, Satt339, P12396A-1, Satt358, Satt487, Satt259, Satt420, Satt576, Satt633, Satt477, Satt581, Satt153, Satt243, P10793A-1, P12391A-1, P12392A-1, P13560A-1, P13561A-1, S60021-TB, S60048-TB, S60076-TB, S60148-TB, S60149-TB, S60201-TB, S60243-TB, S60326-TB, S60338-TB, S60350-TB, S60361-TB, S60422-TB, S60440-TB, S60446-TB, S60505-TB, S60513-TB, S60519-TB, S60536-TB, S60552-TB, S60585-TB, S60630-TB, S60728-TB, S60812-TB, SAC1677, SAC1724, SAG1055, Satt040, Satt111, Satt176, Satt219 and Satt299. In some embodiments the markers of the set are selected from among: Satt684, Satt042, Satt364, Satt454, Satt526, Satt300, Satt591, Satt155, Satt385, Satt632-TB, Satt429, SAT-261, P10641A-1, Satt556, P10638B-2, Satt399, Satt361, Satt661-TB, Satt190, SAT.sub.--311-DB, Satt338, Satt640-TB, Satt557, Satt319, SAT.sub.--142-DB, Satt321, Satt203, Satt129, Satt147, SAT.sub.--351, P10621B-2, Satt701, Satt634, Satt582, Satt389, Satt464, Satt662, Satt672, Satt573, Satt598, Satt263, Satt151, SAT.sub.--273-DB, Satt146, Satt193, Satt569, Satt343, Satt586, Satt040, Satt595, Satt334, Satt144, Satt522, Satt570, Satt356, Satt199, Satt517, Satt191, Sat 117, Satt279, Satt181, Satt127, Satt270, Satt292, SAG1223, SAC1699, Sat 065, Satt596, Satt406, Satt380, Satt183, Satt529, Satt242, Satt617, Satt240, SAT.sub.--301, Satt418, Satt398, Satt497, Satt166, Satt448, Satt373, Satt513, P12394A-1, SAG1048, Satt536, Satt175, Satt677, Satt680, P10615A-1, Satt551, SAT.sub.--330-DB, P13069A-1, P5467A-1, P5467A-2, SAT.sub.--084, SAT.sub.--275-DB, Satt660, Satt339, Satt358, Satt487, Satt487, Satt420, Satt576, Satt633, Satt581, Satt153, Satt243, P10793A-1, P13560A-1, P13561A-1, S60021-TB, S60048-TB, S60076-TB, S60148-TB, S60149-TB, S60201-TB, S60243-TB, S60326-TB, S60338-TB, S60350-TB, S60361-TB, S60422-TB, S60440-TB, S60446-TB, S60505-TB, S60513-TB, S60519-TB, S60536-TB, S60552-TB, S60585-TB, S60630-TB, S60728-TB, S60812-TB, SAC1677, SAC1724, SAG1055, Satt111, Satt219 and Satt299. In certain embodiments the markers are selected from the set including: Satt684, Satt526, Satt591, Satt385, Satt632-TB, Satt429, SAT-261, P10641A-1, Satt556, P10638B-2, Satt190, SAT.sub.--311-DB, Satt338, Satt640-TB, Satt557, SAT.sub.--142-DB, Satt321, Satt203, Satt129, SAT.sub.--351, Satt701, Satt582, Satt389, Satt464, Satt672, Satt598, Satt343, Satt595, Satt334, Satt144, Satt522, Satt570, Satt356, Satt199, Sat 117, Satt279, Satt181, Satt127, Satt270, Satt292, SAG1223, Sat 065, Satt529, Satt242, Satt617, SAT.sub.--301, Satt398, Satt497, Satt166, Satt373, SAG1048, Satt680, P10615A-1, SAT.sub.--330-DB, P13069A-1, SAT.sub.--275-DB, Satt339, Satt487, Satt420, Satt581 and Satt153.

Typically the set of markers includes between about 10% and about 100% of the markers shown to be relevant in a selected geographic region. Usually, the set includes between about 10% and about 90% of the relevant markers. Frequently, the set includes a majority of the relevant markers. In some embodiments, the set includes essentially all of the markers shown to be relevant in a particular geographic region.

BRIEF DESCRIPTION OF THE DRAWINGS

FIGS. 1A-E. Schematic illustration of genetic map indicating positions of markers.

FIG. 2. Genetic map indicating position of marker loci associated with yield in Iowa.

DETAILED DESCRIPTION

The present invention provides soybean markers associated with loci important for soybean yield. Using methods described in U.S. Pat. No. 5,437,697, which is incorporated in its entirety for all purposes, a series of breeding bias analyses were conducted to identify genetic markers that define regions of the soybean genome that are important for yield. Each analysis identified loci that were affected by selection in one of seven different soybean growing regions in North America. For each geographic region, an "elite population" of between 38 and 86 representative elite lines was chosen by an experienced soybean breeder. Each elite line was evaluated for up to 309 molecular markers to determine its allelic genotype at each of 309 different genetic loci spanning the soybean genome.

In addition to determining the marker genotypes for these elite lines, the most relevant leaf ancestors for each representative elite line were genotyped with the same 309 genetic markers. A "leaf ancestor" is an ancestor for whom the previous parents are unknown, representing an endpoint in the pedigree of each elite line. The breeding bias analysis uses computer simulation and the known pedigree structure between the elite lines and the leaf ancestors to determine the "expected" frequency of each marker allele within the elite population assuming no bias due to selection. The expected frequency is merely the average frequency with which a given allele would be expected in the elite population due to the rules of random Mendelian segregation. The simulation uses the actual pedigrees of each elite line to determine the path that each allele must take during the simulated inheritance process. For example, for any diploid biparental cross within a pedigree, the simulation assumes a 50-50 chance that a given parent allele will be passed on to a given progeny from that cross. By knowing the genotypes of the ancestors and the pedigree of a given elite line, one can simulate the inheritance of each allele through a pedigree structure to determine how often that allele would be expected in the elite line according to a purely random process.

However, plant breeding is not a random process; breeders purposely select for characteristics that provide adaptation and high grain yield in specific geographic regions. By practicing many cycles of genetic recombination and selection of the best genotypes for a given region, breeders indirectly "bias" the gene pool towards the alleles that provide the best grain yield in that locale. Using this logic, any marker allele that was inherited significantly more frequently than expected by random simulation, must reside in a genomic region (chromosome segment) that contributes either directly or indirectly to high grain yield.

Following identification of regions of the soybean genome important for yield using the Breeding Bias analysis, specific marker alleles associated with increased yield can be identified in lines and sublines of soybeans within a breeding program. Since favorable allelic forms of chromosome segments are linked to and defined by genetic markers, accurate selection based on genotype can then replace inefficient selection based solely on phenotype. The end result is more efficient progress towards a genotype with the favorable allelic forms with respect to yield being fixed within the elite gene pool.

Definitions

Before describing the present invention in detail, it is to be understood that this invention is not limited to particular biological systems, e.g., soybean lines, or reagents, such as particular markers, which can, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting. As used in this specification and the appended claims, the singular forms "a," "an" and "the" include plural referents unless the content clearly dictates otherwise. The term "plurality" is used to mean "two or more." Thus, for example, reference to "a marker" includes a single marker as well as a plurality of markers, such as two or more markers; and the like.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Exemplary methods and materials are described herein, however, any methods and materials similar or equivalent to those described herein, such as additional or alternative markers physically and genetically linked to the markers (and alleles) described herein, can be used in the practice of the present invention. In describing and claiming the present invention, the following terminology will be used in accordance with the definitions set out below.

The term "germplasm" refers to an individual, a group of individuals, or a clone representing a genotype, variety, species or culture, or the genetic material thereof.

In the context of this disclosure, the term "yield" refers to the productivity per unit area of a particular plant product of commercial significance. For example, yield of soybean is commonly measured in bushels of seed per acre or metric tons of seed per hectare per season. Yield is affected by both genetic and environmental factors. "Agronomics," "agronomic traits," and "agronomic performance" refer to the traits (and underlying genetic elements) of a given plant variety that contribute to yield over the course of growing season. Individual agronomic traits include emergence vigor, vegetative vigor, stress tolerance, disease resistance, herbicide resistance, branching, flowering, seed set, seed size, seed density, standability, threshability and the like. Yield is, therefore, the final culmination of all agronomic traits.

The term "genetic element" or "gene" refers to a heritable sequence of DNA, i.e., a genomic sequence, with functional significance. The term "gene" can be used to refer to, e.g., a cDNA and/or an mRNA encoded by a genomic sequence, as well as to that genomic sequence.

"Locus" refers to a specific chromosome location in the genome of a species where a specific gene can be found. The term "quantitative trait locus" or "QTL" refers to a genetic locus with at least two alleles that differentially affect the expression of a phenotypic trait on at least one genetic background, e.g., in at least one breeding population or sample of progeny.

The term "chromosome segment" designates a contiguous linear span of genomic DNA that resides in planta on a single chromosome. The genetic elements or genes located on a single chromosome segment are physically linked. In the context of the present invention the genetic elements located within a chromosome segment are also genetically linked, typically within a genetic recombination distance of less than or equal to 10 centimorgan (CM). That is, two genetic elements within a single chromosome segment undergo recombination during meiosis with each other at a frequency of less than or equal to about 10%.

"Allele" refers to one of two or more different DNA sequences at a specific locus. In the example of a specific locus where a gene for growth habit is located, one allele is a specific DNA sequence that, e.g., codes for determinate growth habit while another allele is a different DNA sequence that codes for indeterminate growth habit. A "favorable allele" is the allele at a particular locus that confers, or contributes to, an agronomically desirable phenotype, e.g., increased yield. A favorable allele of a marker is an allele associated with a favorable allele at a linked locus which confers or contributes to an agronomically desirable phenotype, e.g., increased yield. A favorable allelic form of a chromosome segment is a chromosome segment including a DNA sequence that contributes to superior agronomic performance at one or more genetic loci physically located on the chromosome segment.

"Allele frequency" refers to the frequency (proportion or percentage) at which an allele is present at a locus within an individual, within a line, or within a population of lines. For example, regarding the allele "A," diploid individuals of genotype "AA," "Aa," or "aa" have allele frequencies of 1.0, 0.5, or 0.0, respectively. One can estimate the allele frequency within a line by averaging the allele frequencies of a sample of individuals from that line. Similarly, one can calculate the allele frequency within a population of lines by averaging the allele frequencies of lines that make up the population. For a population with a finite number of individuals or lines, an allele frequency can be expressed as a count of individuals or lines containing the allele.

A "genetic marker" is any qualitatively (discretely) inherited phenotype that can be used to monitor the segregation of alleles at loci that are genetically linked to the marker. Genetic markers include visible traits such as flower color; enzyme variants such as isozymes and molecular markers such as simple sequence repeats (SSRs), single nucleotide polymorphisms (SNPs), e.g., allele specific hybridization (ASH) markers, restriction fragment length polymorphisms (RFLPs) or randomly amplified polymorphic DNA (RAPDs), etc. Thus, a "marker allele," alternatively an "allele of a marker locus" is one of a plurality of polymorphic nucleotide sequences at a marker locus.

"Codominant markers" reveal the presence of each allele (two per diploid individual) at a locus, e.g., SSR, SNP (e.g., ASH), RFLP, AFLP markers. "Dominant markers" reveal the presence of only a single allele per locus, e.g., RAPD markers. The presence of the dominant marker phenotype (e.g., a band of DNA) is an indication that one allele is present in either the homozygous or heterozygous condition. The absence of the dominant marker phenotype (e.g., absence of a DNA band) is merely evidence that some other, undefined, allele is present. In the case of populations where individuals are predominantly homozygous and loci are predominantly dimorphic, dominant and codominant markers are equally valuable. As individuals within populations become more heterozygous and multi-allelic, codominant markers become more informative of genotype than dominant markers.

A "set" of markers refers to a collection or group of markers, or the data derived therefrom, used for a common purpose, e.g., identifying soybean plants with increased yield. Frequently, the data is stored in an electronic medium. While each of the members of the set has been shown to possess utility with respect to the specified purpose: individual markers selected from the set as well as subsets including some, but not all of the markers, are also effective in achieving the specified purpose.

A "genetic map" is a description of the genetic linkage relationships among loci on one or more chromosomes (or linkage groups) within a given species, generally depicted in a diagrammatic or tabular form. "Mapping" is the process of defining the linkage relationships of loci through the use of genetic markers, populations segregating for the markers, and standard genetic principles of recombination frequency. A "map location" is an assigned location on a genetic map relative to linked genetic markers where a specified marker can be found within a given species.

A "genotype" is the genetic constitution of an individual (or group of individuals) at one or more genetic loci. Genotype is defined by the allele(s) of one or more known loci that the individual has inherited from its parents. A "haplotype" is the genotype of an individual at a plurality of genetic loci. Typically, the genetic loci described by a haplotype are physically and genetically linked, i.e., on the same chromosome segment.

An individual is "homozygous" if the individual has only one type of allele at a given locus (e.g., a diploid individual with two copies of the same allele at a locus). An individual is "Heterozygous" if more than one allele type is present at a given locus (e.g., a diploid individual with one copy each of two different alleles). The term "homogeneity" indicates that members of a group have the same genotype at one or more specific loci. In contrast, the term "heterogeneity" is used to indicate that individuals within the group differ in genotype at one or more specific loci.

A "line" or "strain" is a group of individuals of identical parentage that are generally inbred to some degree and are generally homozygous and homogeneous at most loci.

An "elite line" or "elite strain" is a genetically superior line that has resulted from many cycles of breeding and selection for superior agronomic performance. Numerous elite lines are available and known to those of skill in the art of soybean breeding. An "elite population" is an assortment of elite lines that can be used to represent the state of the art in terms of agronomically superior genotypes of a given crop species, such as soybean. Similarly, an "elite germplasm" or elite strain of germplasm is a genetically superior germplasm, typically derived from and/or capable of giving rise to a plant with superior agronomic performance, such as an existing or newly developed elite line of soybean.

In contrast, an "exotic germplasm" is a germplasm derived from a soybean not belonging to an available elite soybean line or strain of germplasm. In the context of a cross between two soybean plants or strains of germplasm, an exotic germplasm is unrelated by descent to the elite germplasm with which it is crossed. Most commonly, the exotic germplasm is not derived from any known elite line of soybean, but rather is selected to introduce novel genetic elements (novel alleles) into a breeding program.

An "ancestral line" is a parent used as a source of genes for the development of elite lines. An "ancestral population" is a group of ancestors that have contributed the bulk of the genetic variation that was used to develop elite lines. "Descendants" are the progeny of ancestors, and may be separated from their ancestors by many generations of breeding. For example, elite lines are the descendants of their ancestors. A "pedigree structure" defines the relationship between a descendant and each ancestor that gave rise to that descendant. A pedigree structure can span one or more generations, describing relationships between the descendant and it's parents, grand parents, great-grand parents, etc.

The term "subline" refers to a an inbred subset of descendents that genetically distinct from other similarly inbred subsets descended from the same progenitor. Traditionally, a "subline" has been derived by inbreeding the seed from an individual soybean plant selected and at the F3 to F5 generation until the residual segregating loci are "fixed" or homozygous across most or all loci. Commercial soybean varieties (or lines) are typically produced by aggregating ("bulking") the self-pollinated progeny of a single F3 to F5 plant from a controlled cross between 2 genetically different parents. While the variety typically appears uniform, the self-pollinating variety derived from the selected plant eventually (e.g., F8) becomes a mixture of homozygous plants that can vary in genotype at any locus that was heterozygous in the originally selected F3 to F5 plant. In the context of the invention, marker-based sublines, that differ from each other based on qualitative polymorphism at the DNA level at one or more specific marker loci, are derived by genotyping a sample of seed derived from individual self-pollinated progeny derived from a selected F3-F5 plant. The seed sample can be genotyped directly as seed, or as plant tissue grown from such a seed sample. Optionally, seed sharing a common genotype at the specified locus (or loci) are bulked providing a subline that is genetically homogenous at identified loci important for increased yield.

The term "near-isogenic" lines refers to lines that are genetically similar to each other except at one or a small number of genetic loci (e.g., at 1, 2, or about 5 to about 10 specified genetic loci). These can be created as described for marker-based sublines or based on differences for any qualitative trait that can serve as an effective genetic marker. Percent similarity between near-isogenic lines is a function of the similarity of the parents of the original cross and the generation at which self-pollination is performed. On average, the relatedness between members of a given inbred line increases 50% with each cycle of inbreeding, due to a 50% increase in homozygosity at each cycle of inbreeding. Percent similarity can be more accurately determined with genetic markers that span the genome. In some cases, near-isogenic lines differ from each other at one defined genetic locus.

"Transgressive segregation" is an inheritance pattern that results in a phenotype (e.g., agronomic performance) of an individual that is more extreme than either parent. For example, with respect to agronomic performance, transgressive segregation results in a progeny with yield that is greater than a best parent or less than a worst parent. Desirable transgressive segregation is the case where the progeny are better than either parent. Transgressive segregation can also be measured in terms of the number of favorable alleles that an individual inherits in relation to the number of favorable alleles of each of its parents. A "target segregant" is a progeny from a specific cross that includes only favorable alleles at each defined locus segregating in the cross. The target segregant therefore, has the best possible genotype that can result from a cross between parents that differ in genotype at known loci. "Target genotype" refers to an individual containing the favorable allelic forms at all chromosome segments or loci known to affect a particular trait or phenotype, such as agronomic performance. With respect to agronomic performance, the target genotype is that of the target segregant from a cross between parents that complement in terms of favorable alleles at all defined loci affecting agronomic performance.

A "survey" or "genetic survey" or "genetic marker survey" is the process of determining and recording the genotype of individuals or lines (e.g., ancestral and elite lines), at any number of defined loci, with the use of genetic markers.

The term "associated with" or "associated," when referring to a nucleic acid (e.g., a genetic marker) and a phenotype in the context of the present invention, refers to a nucleic acid and a phenotypic trait that are in linkage phase disequilibrium. The term "linkage phase disequilibrium" or "linkage disequilibrium" refers to a non-random segregation of genetic loci. This implies that such loci are in sufficient physical proximity along a length of a chromosome that they tend to segregate together with greater than random frequency.

The term "genetically linked" refers to genetic loci (including genetic marker loci) that are physically close enough to each other on the same chromosome such that they have a recombination frequency of less than 0.5. When referring to the relationship between two genetic elements, such as a genetic element contributing to yield and a proximal marker, "Coupling" phase linkage indicates the state where the "favorable" allele at the yield locus is physically associated on the same chromosome strand as the "favorable" allele of the respective linked marker locus. In coupling phase, both favorable alleles are inherited together by progeny that inherit that chromosome strand. In "repulsion" phase linkage, the "favorable" allele at the yield locus is physically linked with an "unfavorable" allele at the proximal marker locus, and the two "favorable" alleles are not inherited together (i.e., the two loci are "out of phase" with each other).

The term "physically linked" is used to indicate that two genetic loci, e.g., two marker loci, a marker locus and a locus contributing to variation in a phenotype, are physically present on the same chromosome. Typically, the two loci are located in close proximity, such that recombination between homologous chromosome pairs does not occur between the two loci with high frequency. That is, recombination between two physically linked loci typically occurs with a frequency of less than about 10%, favorably with a frequency of less than 5%, more favorably with a frequency of 2% or less or a frequency of 1% or less. Thus, two loci that are localized to the same chromosome, and at such a distance that recombination between the two loci occurs at a frequency of less than 10% are said to be "proximal to" each other.

"Marker Assisted Selection" or "MAS" refers to the practice of selecting for desired phenotypes among members of a breeding population using genetic markers.

The phrase "hybrid plants" refers to plants which result from a cross between genetically different individuals.

The term "crossed" or "cross" in the context of this invention means the fusion of gametes, e.g., via pollination to produce progeny (i.e., cells, seeds, or plants) in the case of plants. The term encompasses both sexual crosses (the pollination of one plant by another) and, in the case of plants, selfing (self-pollination, i.e., when the pollen and ovule are from the same plant).

"Random mating" is the mating of individuals within a population in a way that insures the equal probability of any two individuals mating regardless of genotype. "Non-random mating" is any deviation from random mating in which specific crosses between individuals occur with greater frequency than others.

The term "introgression" refers to the transmission of a desired allele of a genetic locus from one genetic background to another. For example, introgression of a desired allele at a specified locus can be transmitted to at least one progeny via a sexual cross between two parents of the same species, where at least one of the parents has the desired allele in its genome. Alternatively, for example, transmission of an allele can occur by recombination between two donor genomes, e.g., in a fused protoplast, where at least one of the donor protoplasts has the desired allele in its genome. The desired allele can be, e.g., a selected allele of a marker or QTL or a transgene.

The terms "nucleic acid," "polynucleotide," "polynucleotide sequence" and "nucleic acid sequence" refer to single-stranded or double-stranded deoxyribonucleotide or ribonucleotide polymers, or chimeras thereof. As used herein, the term can additionally or alternatively include analogs of naturally occurring nucleotides having the essential nature of natural nucleotides in that they hybridize to single-stranded nucleic acids in a manner similar to naturally occurring nucleotides (e.g., peptide nucleic acids). Unless otherwise indicated, a particular nucleic acid sequence of this invention optionally encompasses complementary sequences, in addition to the sequence explicitly indicated.

The term "homologous" refers to nucleic acid sequences that are derived from a common ancestral gene through natural or artificial processes (e.g., are members of the same gene family), and thus, typically, share sequence similarity. Typically, homologous nucleic acids have sufficient sequence identity that one of the sequences or its complement is able to selectively hybridize to the other under selective hybridization conditions. The term "selectively hybridizes" includes reference to hybridization, under stringent hybridization conditions, of a nucleic acid sequence to a specified nucleic acid target sequence to a detectably greater degree (e.g., at least 2-fold over background) than its hybridization to non-target nucleic acid sequences and to the substantial exclusion of non-target nucleic acids. Selectively hybridizing sequences have about at least 80% sequence identity, preferably at least 90% sequence identity, and most preferably 95%, 97%, 99%, or 100% sequence identity with each other. A nucleic acid that exhibits at least some degree of homology to a reference nucleic acid can be unique or identical to the reference nucleic acid or its complementary sequence.

The term "isolated" refers to material, such as a nucleic acid or a protein, which is partially or substantially free from components that normally accompany or interact with it in its naturally occurring environment. The isolated material optionally comprises material not found with the material in its natural environment, e.g., a cell. In addition, if the material is in its natural environment, such as a cell, the material has been placed at a location in the cell (e.g., genome or subcellular organelle) not native to a material found in that environment. For example, a naturally occurring nucleic acid (e.g., a promoter) is considered to be isolated if it is introduced by non-naturally occurring means to a locus of the genome not native to that nucleic acid. Nucleic acids which are "isolated" as defined herein, are also referred to as "heterologous" nucleic acids.

The term "recombinant" when referring to a molecular species, such as a nucleic acid or protein, indicates that the material (e.g., a nucleic acid or protein) has been synthetically (non-naturally) altered by human intervention. The alteration to yield the synthetic material can be performed on the material within or removed from its natural environment or state. For example, a naturally occurring nucleic acid is considered a recombinant nucleic acid if it is altered, or if it is transcribed from DNA which has been altered, by means of human intervention, e.g., performed on the cell from which it originates. When the term "recombinant" is used in the classical genetic sense, it refers to an individual with one of the many possible rearrangements of genes due to natural sexual recombination. For example, "recombinant inbred lines" or "RILs" are merely the variety of inbred progeny from specific crosses of divergent parents. The manner in which the term recombinant is employed will be self evident from the context of its use.

The term "introduced" when referring to a heterologous or isolated nucleic acid refers to the incorporation of a nucleic acid into a eukaryotic or prokaryotic cell where the nucleic acid can be incorporated into the genome of the cell (e.g., chromosome, plasmid, plastid or mitochondrial DNA), converted into an autonomous replicon, or transiently expressed (e.g., transfected mRNA). The teen includes such nucleic acid introduction means as "transfection," "transformation" and "transduction."

The term "host cell" means a cell that contains a heterologous nucleic acid, such as a vector, and supports the replication and/or expression of the nucleic acid. Host cells may be prokaryotic cells such as E. coli, or eukaryotic cells such as yeast, insect, amphibian, or mammalian cells. In the context of the present invention, a eukaryotic host cell is most commonly a soybean cell.

The term "transgenic" plant (or animal) refers to a plant (or animal) which comprises within its genome a heterologous polynucleotide. Generally, the heterologous polynucleotide is stably integrated within the genome such that the polynucleotide is passed on to successive generations. The heterologous polynucleotide may be integrated into the genome alone or as part of a recombinant expression cassette. "Transgenic" is used herein to refer to any cell, cell line, tissue, part or organisms, the genotype of which has been altered by the presence of heterologous nucleic acid including those transgenic organisms or cells initially so altered, as well as those created by crosses or asexual propagation from the initial transgenic organism or cell. The term "transgenic" as used herein does not encompass the alteration of the genome (chromosomal or extra-chromosomal) by conventional breeding methods (i.e., crosses) or by naturally occurring events such as random cross-fertilization, viral infection with non-recombinant nucleic acids, bacterial transformation with non-recombinant nucleic acids, transposition with non-recombinant nucleic acids, or spontaneous mutation. Examples of processes by which a transgenic organism can be produced are described below, and include electroporation, microinjection, Agrobacterium-mediated transformation, biolistic methods, in planta techniques, and the like.

The term "plant" includes any of: whole plants, plant organs (e.g., leaves, stems, roots, etc.), tissues, seeds, plant cells, and/or progeny of the same. Similarly, "plant cell," as used herein includes, without limitation, seeds, suspension cultures, embryos, meristematic regions, callus tissue, leaves, roots, shoots, gametophytes, sporophytes, pollen, and microspores. In addition, the term "plant" encompasses in silico representations of part or all of a plant's genetic constitution.

Introduction

The present invention addresses the need in the field of agriculture to more efficiently develop soybean plants having superior agronomic performance. Superior agronomic performance, as measured by increased yields of soybeans, is a function of such diverse factors as seedling emergence vigor, resistance to environmental stress, pest resistance, insect resistance, disease resistance, ability to mine nutrients from the soil, ability to produce flowers, photosynthetic ability, and ability to shuttle photosynthate into grain, etc. As disclosed herein, genetic loci associated with superior agronomic performance have been identified by analysis of a plurality of soybean breeding programs (some of which extend back more than 70 years) in a variety of geographic zones in the United States and Canada.

Soybean germplasm having superior agronomic performance (relative to their parents and sibs developed in these same breeding programs) show a statistically significant retention of particular allelic forms (alternatively, "alleles") encompassed within the chromosome segments of the present invention. This highly significant statistical association demonstrates that loci within these chromosome segments are linked (genetically and physically) to genetic elements associated with the various traits involved in determining soybean yield in the context of modern agricultural practices. Collectively, favorable attributes corresponding to such traits are descriptively referred to as "superior agronomic performance," and contribute to increased yield. Consequently, molecular markers localized within these chromosome segments can be used to define (and identify) soybean plants with superior agronomic performance, and in marker assisted selection ("MAS") and marker assisted breeding strategies (alternatively referred to as "molecular breeding") to create soybean plants with superior agronomic performance. Furthermore, chromosome segments encompassing the genetic elements associated with the phenotype of superior agronomic performance can be isolated and transformed into soybean or other monocot or dicot plant species.

The methodology used to identify these chromosome segments, referred to as "Breeding Bias" is disclosed in U.S. Pat. No. 5,437,697 to Sebastian et al., incorporated herein in its entirety for all purposes.

Briefly, loci (e.g., markers and chromosome segments encompassing genetic elements contributing to superior agronomic performance) that have been affected by selection for agronomic performance, are identified by comparing the genotype of modern elite lines with that of their ancestors. Because domesticated soybeans are known to have a fairly narrow gene pool and have been selected to fairly stringent standards, a relatively small number of elite lines is adequate to identify relevant chromosome regions associated with superior agronomic performance. The identity of elite lines used for each geographical region is indicated in Table 1.

Based on the selection of elite lines, the relevant ancestral population, e.g., ancestors that were used most frequently by breeders to develop the elite population is identified. A pedigree tracing the relationship between each elite line and its earliest known ancestors is obtained, and the genetic contribution of each ancestor is converted into a proportional or percentage representation, assuming that on average 50% of each parent's genome is passed on to each progeny as a result of a two-way cross with another parent. By tracing the pedigree back until no more branch points are found, the earliest known ancestors can be identified and their contribution to each elite line calculated. Calculations are performed, generally in a computerized format, for each of the elite lines included in the genetic survey.

Once the appropriate elite and ancestral lines have been chosen, the genotype of each line is determined through the use of genetic markers. Genetic markers include any qualitative phenotype that can be used as a direct measure of genotype at a specific locus. Markers include visual traits such as flower color, enzyme variants such as isozymes, and molecular markers, which can be detected by a variety of means such as simple sequence repeats (SSR), single nucleotide polymorphism (SNP), allele specific hybridization (ASH), restriction fragment length polymorphism (RFLP), amplified variable sequences, single strand conformation polymorphism (SSCP), amplified fragment length polymorphism (AFLP) and randomly amplified polymorphic DNA (RAPD).

Regardless of which genetic markers are used to monitor genotype, the end result is a marker genotype for each of the elite and ancestral lines. The genotype of each line is merely an indication of which allele the line possesses at any number of loci defined by the genetic markers.

Once one has determined the genotypes of ancestral and elite lines, statistical analyses are used to determine whether selection for superior agronomic performance has favored particular alleles at certain loci. The first statistic to calculate is the probability of finding each allele within the elite population with the assumption that selection had no effect on allele frequency. This expected allele frequency within the elite population serves as a basis for comparison to the observed allele frequency.

Expected allele frequency within the elite population is a function of the genotype of each ancestor and the pedigrees of elite lines representing the elite population. In a random mating population, the allele frequency among descendants should be similar to allele frequency among ancestors unless breeding and selection has favored particular alleles. However, since breeding of many crops (including soybeans) is not done through random mating, one can use the pedigree of each descendant (e.g., elite line) to calculate the probability of inheriting a given allele from its ancestors. Within non-random mating populations, expected allele frequency can be obtained by averaging the individual probabilities of inheriting an allele over any number of descendants (that may differ greatly in pedigree).

By comparing the observed frequency of a given allele in the elite population to the average probability of inheriting that allele (i.e., comparing observed count to expected count), one can determine which loci have been affected by historical selection for agronomic traits. Favorable alleles are identified as the ones that have been inherited more frequently than expected (i.e., have been favored by selection). Unfavorable alleles are those inherited less frequently than expected (i.e., selected against). A statistical test is then used, e.g., as described in detail in U.S. Pat. No. 5,437,697, to determine the significance of a difference between observed and expected allele frequency.

According to these methods, loci and alleles with significant deviations from expected allele frequency correlating with superior agronomic performance in different growing environments have been identified. These loci can be used to define and identify, as well as select for soybeans with superior agronomic performance. For example, the markers disclosed herein can be used to 1) identify soybean germplasm with superior and/or improved agronomic performance, e.g., relative to presently existing or parental soybean lines; 2) identify parents that will produce superior transgressive segregants; 3) select superior lines from crosses that are segregating at loci (e.g., QTL loci) which contribute to superior agronomic performance; 4) select parents that will produce the best hybrids; 5) purify heterogeneous lines, i.e., by selecting only those individuals that include the favorable allele(s) at loci that are still segregating within the line; 6) select for and maintain desirable heterogeneity; 7) maintain favorable alleles at multiple loci that have been assembled by many years of selection while incorporating exotic alleles from new germplasm at other loci; 8) to test the effects of exotic allele substitution at loci that have proven important for domestication, e.g., in the event that an exotic allele provides better agronomic performance at the loci identified by breeding bias; and, 9) in any process where it is important to prioritize which loci are more important for agronomic fitness than random loci within the genome.

Markers and Alleles Correlating with Superior Agronomic Performance in Soybeans

In one aspect, the present invention provides marker loci correlated with superior agronomic performance in soybean. Each of the identified markers is expected to be in close physical and genetic proximity (i.e., physically and genetically linked) to a genetic element, e.g., a quantitative trait locus or QTL, that contributes to superior agronomic performance. If a particular marker were not in proximity to an important QTL, the extended period of recurrent selection (70+ years for soybean) would have provided many opportunities for crossing over between the marker and QTL. This would result in disassociation between the marker allele and the QTL allele resulting in "linkage equilibrium" and statistically non-significant estimates of correlation between the marker and yield, i.e., LOD or probability scores. Breeding bias does not detect poorly-linked markers, that is, markers that are distant from important loci, even if both the marker and the genetic element (e.g., QTL) contributing to yield are found on the same chromosome. In addition, since thousands of different environments have been sampled to test performance during each cycle of selection, alleles that provide adaptation to a wide range of environments will be most readily identified. Alleles that are only favorable under rare environmental conditions will not consistently increase in frequency due to selection in different environments and will, therefore, not be detected by breeding bias analysis. Furthermore, the narrow gene pool and high relatedness among elite soybean germplasm shared by both public and private institutions (Delanney et al, 1983, Crop Science 23:944-949) act to homogenize the gene pool and make marker-QTL associations more reliable. Taken together, these features in combination with the large body of data analyzed by breeding bias, ensure that QTL with a substantial contribution to yield are located in close proximity to the markers disclosed herein.

Accordingly, each of the disclosed markers defines a chromosome segment associated with a genetic element, e.g., a QTL contributing to superior agronomic performance. One of skill in the art will recognize that for each of the chromosome segments encompassing QTL related to yield, identification of and/or selection for the QTL is optimized by using a genetic marker that is as close as possible to the actual QTL locus that is responsible for the phenotype in question. Thus, a "perfect" marker would be one that is localized within the genetic element or QTL itself, and corresponds to the DNA polymorphism that is responsible for the superior phenotype. That is, the marker polymorphism is the mutation underlying the improvement in yield. However, since most of the genetic markers available for soybean consist of RFLPs, SSRs, RAPDs and SNPs of unknown function, it would be highly unlikely that a given marker from those currently available was already "perfect." Nevertheless, the markers described herein constitute a set of tools for detecting important chromosome segments comprising QTL associated with yield. These markers are sufficiently close to their respective linked QTL to detect a statistically significant shift in allele frequency (due to selection) over 70 years of recurrent selection for yield, thus, are useful for the purposes of identifying desirable germplasm and for MAS. In addition, these markers are useful for identifying additional markers, e.g., including a "perfect" marker within the QTL gene of interest.

Tables 3 through 12 disclose exemplary molecular, which define the chromosome segments that are embodiments of the present invention. Each of Tables 3 through 12 provides marker loci and favorable alleles, identified by Breeding Bias, relevant in a specified growing environment distinguished by geographic region.

The exemplary markers provided in Tables 3 through 12 identify chromosome segments including genetic elements (genes) important for yield in soybean. The chromosome segments of the present invention are contiguous lengths of chromosome delimited by a specified crossover frequency or map distance (centimorgans or CM) from a molecular marker of the present invention. The chromosome segments of the present invention are delimited by a crossover frequency of up to about 10%, i.e., 10 CM, from a marker locus known to be associated with superior agronomic performance, e.g., Satt165; Satt042; Satt364; Satt454; Satt526; Satt300; Satt591; Satt155; Satt385; Satt511; P12390B-1; Satt327; Satt329; Satt508; P10635A-1; Satt409; Satt228; Satt429; Satt509; Satt197; SCT.sub.--026; Satt415; Satt583; Satt430; P12198A-1; P8584A-1; Satt359; P10648A-1; P10641A-1; Satt168; Satt556; Satt272; Satt020; Satt534; P1063813-2; Satt399; Satt361; P10639A-1; Satt190; Satt338; Satt227; Satt457; Satt557; Satt319; Sat.sub.--1460; Satt307; SCT.sub.--028; Satt433; Satt357; Satt321; Satt267; Satt295; Satt203; Satt507; SAT.sub.--110; P10620A-1; Satt129; Satt147; Satt216; P10621B-2; Satt558; Satt266; Satt282; Satt537; Satt506; P13072A-1; Satt582; Satt389; Satt461; Satt514; Satt464; Satt543; P13074A-1; P10624A-1; Satt573; Satt598; Satt204; Satt263; Satt491; Satt602; Satt151; Satt355; Satt452; Satt146; Satt193; Satt569; Satt343; Satt586; Satt423; Satt348; Satt595; P10782A-1; P3436A-1; Satt334; Satt510; Satt144; Satt522; P9026A-1; P10646A-1; P5219A-1; P7659A-2; Satt570; Satt356; Satt130; Satt115; Satt594; Satt533; Satt303; Satt352; Satt566; Satt199; Satt503; Satt517; Satt191; SAT.sub.--117; Satt353; Satt442; Satt279; Satt314; Satt181; Satt367; Satt127; Satt270; Satt440; P10640A-1; Satt249; SCT.sub.--065; Satt596; Satt280; Satt406; Satt380; Satt183; Satt529; Satt431; Satt242; Satt102; Satt240; P10618A-1; Satt523; Satt398; Satt497; Satt166; Satt448; Satt373; Satt513; P12394A-1; Satt590; Satt220; Satt536; Satt175; P10615A-1; Satt250; Satt346; Satt336; P13069A-1; P5467A-1; Satt584; SAT.sub.--084; Satt387; Satt339; P12396A-1; Satt487; Satt259; Satt347; Satt420; Satt576; Satt550; Satt262; Satt473; Satt477; Satt581; P11070A-1; Satt153; Satt243; P8230A-1; P10623A-1; P10632A-1; P12391A-1; P12392A-1; P13560A-1; P13561A-1; p2481A-1; SAC1677; Satt040; Satt109; Satt111; Satt176; Satt219; Satt299; and Satt512. The genetic element contributing to yield can be localized to any portion of the chromosome segment defined by these molecular markers. For example, a gene encoding a function leading to improved yield can reside within the chromosome segment at a distance of less than 1 CM (at a distance resulting in recombination in fewer than 1% of mitotic events), or at any distance between about 1 CM and 10 CM, e.g., values of approximately 2 CM, 3 CM, 4 CM, 5 CM, 6 CM, 7 CM, 8 CM, or 9 CM, or any value between about 0 CM and about 10 CM. Thus, a chromosome segment is defined as a contiguous length of chromosome extending up to 10 CM in either direction from a designated marker, and including the portion of the chromosome that undergoes crossover with the marker locus at a frequency of no greater than 10%. In many cases, the chromosome segment of interest, is in fact a continuous length extending less than 10 CM, i.e., a length of chromosome that undergoes crossover with the marker at a frequency of less than 10%, e.g., 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less, or any value therebetween. Alternatively, physical distances may be utilized to determine the aforementioned chromosome segments using a conversion factor of 1 (one) Mbp (one million base pairs) for 1 (one) CM of map distance or 1% (one percent) crossover frequency. The actual conversion factor in soybean ranges from about 100 Kbp to close to 1 Mbp depending on the chromosome region. Accordingly, the arbitrary but reasonable conversion factor of 1 Mbp is to be understood in the context of the present invention.

The exemplary favorable alleles of marker loci enumerated herein have been shown, e.g., by breeding bias analysis, to be associated with genetic elements contributing to improved yield in various lines of soybeans. One of skill will appreciate, that this is an empirical association, and that a particular marker locus (and the designated favorable alleles thereof) are used to identify a corresponding chromosome segment having a genetic element that contributes to yield. However, because a marker locus is not necessarily, or even typically, identical to the genetic element which results in enhanced yield, in some percentage of crosses, genetic recombination will occur between the enumerated favorable allele and the genetic element contributing to yield. This does not negate the importance of either the genetic element or the identification of the marker locus and exemplary favorable alleles. Any such recombination events can be detected and subsequent marker assisted selection can be performed using the allele determined to be in coupling linkage phase with the favorable genetic element as discussed in more detail in EXAMPLE 4: SEGREGATION FOR YIELD IN NEAR ISO-GENIC SUBLINES, in the context of detecting residual polymorphisms associated with yield in near iso-genic sublines, and in EXAMPLE 5: ALLELE CONFIRMATION USING RANDOM CROSSES.

In the context of the present invention, the allelic form of multiple chromosome segments is determined, whether the purpose is to define the genotype of a soybean or for marker assisted selection (MAS). In most circumstances, it is desirable to ascertain the allelic form for a large proportion, e.g., all, of the chromosome segments known to contribute to yield in a particular geographic region. However, in some circumstances, particularly when the parents are known to share particular favorable alleles, a subset of the chromosome segments can be employed, reducing time and cost, without losing efficiency. Thus, in the context of the present invention it is common to assess at least 10%, typically between at least 10% and about 90% of the relevant chromosome segments, e.g., by determining the allelic form of the marker loci specified in Tables 3 through 12. Commonly, at least about 25%, frequently at least about 50%, often at least about 75% or more of the allelic forms are determined. For example, at least about 80%, 85%, 90%, 95%, 97%, 98%, 99%. Accordingly, it is generally desirable to determine the allele at a majority of the loci shown to be relevant to agronomic performance in a particular geographic region or growing environment. In one favorable embodiment, the allelic form of a set of markers defining a set of chromosome segments consisting essentially of the markers shown to be relevant to agronomic performance in a particular region are determined. A set of markers is deemed to consist essentially of the markers relevant in a particular region if it includes a sufficient number of markers to prevent a diminishing yield phenotype or to prevent a decrease in efficiency of selection when the set of markers is used for marker assisted selection. Typically such a set will include at least about 90%, 95%, 97%, 98%, 99% or more of the markers. That is, no more than 10% of the markers shown to be relevant in a particular region will be omitted, e.g., no more than 5%, 3%, 2%, or 1% of the allelic forms of the relevant markers will be left undetermined.

Typically, the marker loci evaluated are shown to correlate with superior agronomic performance with a significance of greater that 95%. Often the marker loci are selected that exhibit a significance of greater than 99% within a geographic region of interest. If desired, the allelic form of multiple marker loci within the same chromosome segment can be determined. Frequently, the allelic form of a single marker representing the chromosome segment is determined.

Identification of Residual Polymorphism

The marker loci identified by Breeding Bias are associated with genetic elements contributing to increased yield in soybean. Although particular alleles of the marker loci have been found to be statistically correlated with increased yield according to the Breeding Bias analysis, alleles at one or more marker loci are typically not fixed within an elite line or among progeny derived from a progenitor soybean selected from an elite strain of germplasm. Indeed, such residual polymorphisms provide valuable genetic variation from which improved sublines can be selected. By identifying particular marker loci from among the set of loci shown to be associated with genetic elements contributing to yield, the efficiency of selection can be improved.

To this end, marker loci with one or more segregating alleles in a population of progeny derived from an elite progenitor are evaluated to identify the specific allele correlating with increased yield in the population of progeny. Detailed descriptions of exemplary methods for confirming the favorable allele in a population of progeny are provided in EXAMPLES 4 and 5.

Definition and Identification of Target Germplasm

The marker loci of the present invention can be used as proxies for loci contributing to improved yield to define the theoretically optimal or "target" soybean genotype. Accordingly, alleles of marker loci identified by Breeding Bias, and confirmed to correlate with increased yield in a given environmental or geographic context can be used to define or identify a soybean plant with superior agronomic performance. While existing elite lines include favorable alleles at numerous marker loci (and corresponding functional loci contributing to yield), none of the existing elite lines yet incorporates all of the genetic elements contributing to the ideal soybean genotype. Indeed, prior to the markers of the present invention, it would not have been possible to predict the ideal soybean genotype (or define a target genotype) with respect to yield. Thus, a feature of the invention is the definition of a target soybean genotype for superior agronomic performance. Any soybean plant having an increased number of favorable allelic forms of chromosome segments defined according to the markers of the invention, i.e., that more closely approximates the target soybean genotype than existing elite lines, constitutes a feature of the present invention.

The markers and methods described herein provide the means for identifying and developing soybean plants having the target soybean genotype for superior agronomic performance and genomes having increased numbers of favorable allelic forms of the relevant chromosome segments relative to existing elite lines, and or relative to either parent giving rise to the soybean plant genome. Accordingly, the methods of the invention can be used to produce compositions, including whole plants, plant organs, seeds, and isolated genetic constituents, e.g., including the entire chromosomal complement of the genome, or a subset thereof, such as an individual chromosome or chromosome fragment (all of which are collectively described by the term "soybean plant genome") with an increased number of genetic elements contributing to yield. Methods for separating and isolating genomes or individual chromosomes are well known in the art and include, e.g., flow cytometry and pulse field gel electrophoresis. Replicates of the soybean plant genome are also encompassed within the meaning of the term soybean plant genome. Replicates are identical or substantially identical (i.e., a mutant arising from mitotic division from the same progenitor cell) to the initial soybean plant genome. Replicates can be created, for example, by yeast or bacterial artificial chromosomes or any of a variety of nucleic acid vectors or replication methods such as PCR (polymerase chain reaction).

A soybean plant genome(s) of the present invention can be from an individual soybean plant. As used herein, the term "plant" includes whole plants, plant organs (e.g., leaves, stems, roots, etc.), seeds, suspension cultures, embryos, meristematic regions, callus tissue, leaves, roots, shoots, gametophytes, sporophytes, pollen, and microspores.

Marker Assisted Selection and Breeding

The ultimate goal of any breeding program is to combine as many favorable alleles as possible into elite varieties of germplasm that are genetically superior (with respect to one or more agronomic traits) to their ancestors. The markers provided herein identify chromosome segments, i.e., genomic regions, and alleles (allelic forms) that have been favored by long-term selection for yield. Accordingly, these markers can be used for marker assisted selection of soybean plants with superior agronomic performance. For example, in a cross between parents that complement favorable alleles at the target loci, progeny can be selected that include more favorable alleles than either parent. Such progeny are predicted to be phenotypically superior to either parent as illustrated in Table 2.

Marker assisted selection (MAS), employing the markers of the present invention, and the chromosome segments they identify are useful in the context of a soybean breeding program to increase efficiency in yield improvements. Phenotypic screening for a trait of interest, such as yield, for large numbers of samples can be expensive, as well as time consuming. In addition, phenotypic screening alone is often unreliable due to the effects of epistasis and non-genetic (e.g., environmental) contributions to the phenotype. MAS offers the advantage over field evaluation that it can be performed at any time of year regardless of the growing season or developmental stage. In addition, MAS facilitates evaluation of organisms grown in disparate regions or under different conditions.

A breeder of ordinary skill, desiring to breed soybean plants with increased yield, can apply the methods for MAS described herein, using, e.g., the exemplary markers provided herein or linked markers localized to the chromosome segments identified by markers provided in Tables 3 through 12, to derive soybean lines with superior agronomic performance.

Genetic marker alleles, e.g., the exemplary markers provided Tables 3 through 12, linked markers, QTL, identifying the chromosome segments encompassing genetic elements that are important for yield, are used to identify plants that contain a desired genotype at one or more loci, and that are expected to transfer the desired genotype, along with a desired phenotype to their progeny. Marker alleles (or QTL alleles) can be used to identify plants that contain a desired genotype at one locus, or at several unlinked or linked loci (e.g., a haplotype), and that would be expected to transfer the desired genotype, along with a desired phenotype to their progeny. Similarly, by identifying plants lacking the desired allele, plants with an undesirable phenotype, e.g., plants with poor yield, can be identified, and, e.g., eliminated from subsequent crosses. It will be appreciated that for the purposes of MAS, the term marker can encompass both marker and QTL loci as both can be used to identify plants with a desired phenotype.

For example, MAS can be used to develop lines or strains of soybean and soybean germplasm with superior agronomic performance by identifying favorable allelic forms of chromosome segments shown to be important, e.g., that include a genetic element, for yield. Favorable alleles of markers defining the chromosome segments of interest, e.g., Satt684, Satt165, Satt042, Satt364, Satt454, Satt526, Satt300, Satt591, Satt155, Satt385, Satt385, Satt225, Satt236, Satt511, P12390B-1, Satt480, Satt632-TB, Satt233, Satt327, Satt329, Satt508, P10635A-1, Satt409, Satt228, Satt429, Satt426, Satt509, SAT.sub.--261, Satt197, Satt519, Satt597, SCT.sub.--026, Satt415, Satt583, Satt430, P12198A-1, P8584A-1, Satt359, P10648A-1, P12105A-1, P10641A-1, Satt168, Satt556, Satt272, Satt020, Satt066, Satt534, P10638B-2, Satt399, Satt361, P10639A-1, Satt661-TB, Satt190, SAT.sub.--311-DB, Satt338, Satt227, Satt640-TB, Satt422, Satt457, Satt457, Satt557, Satt319, SAT.sub.--142-DB, Satt460, P13073A-1, Satt307, SCT.sub.--028, Satt433, Satt357, Satt321, Satt267, Satt383, Satt295, Satt203, Satt507, SAT.sub.--110, P10620A-1, Satt129, Satt147, Satt216, SAT.sub.--351, P1062113-2, Satt701, Satt634, Satt558, Satt266, Satt282, Satt537, Satt506, Satt546, P13072A-1, Satt582, Satt389, Satt461, Satt311, Satt514, Satt464, Satt662, Satt543, Satt186, Satt413, Satt672, P13074A-1, P10624A-1, Satt573, Satt598, Satt204, Satt263, Satt491, Satt602, Satt151, Satt355, Satt452, SAT.sub.--273-DB, Satt146, Satt193, Satt569, Satt343, Satt586, Satt040, Satt423, Satt348, Satt595, P10782A-1, P3436A-1, P10598A-1, Satt334, Satt510, Satt510, Satt144, Satt522, Satt522, P9026A-1, P10646A-1, P5219A-1, P7659A-2, Satt570, Satt356, Satt130, Satt115, Satt594, Satt533, Satt303, Satt352, Satt566, Satt199, Satt503, Satt517, Satt191, SAT.sub.--117, Satt353, Satt442, Satt279, Satt314, Satt142, Satt181, Satt367, Satt127, SCTT012, Satt270, Satt292, Satt440, P10640A-1, Satt249, SAG1223, SAC1699, SCT.sub.--065, Satt596, Sat.sub.--1280, Satt406, Satt380, Satt183, Satt529, Satt431, Satt242, Satt102, Satt441, Satt544, Satt617, Satt240, P10618A-1, Satt475, Satt196, SAT.sub.--301, Satt523, Satt418, Satt418, Satt398, Satt497, Satt284, Satt166, Satt448, Satt373, Satt513, P12394A-1, Satt590, Satt567, Satt220, SAG1048, Satt536, Satt175, Satt677, Satt680, P10615A-1, Satt551, Satt250, Satt346, Satt336, SAT.sub.--330-DB, P13069A-1, P5467A-1, P5467A-2, Satt584, SAT.sub.--084, P3050A-2, SAT.sub.--275-DB, Satt387, Satt549, Satt660, Satt339, Satt255, Satt257, Satt358, P12396A-1, Satt487, Satt259, Satt259, Satt347, Satt420, Satt576, Satt550, Satt633, Satt262, Satt473, Satt477, Satt581, P11070A-1, Satt153, Satt243, P8230A-1, P10623A-1, P10632A-1, P10793A-1, P12391A-1, P13560A-1, P13561A-1, P13561A-1, P2481A-1, S60021-TB, S60048-TB, S60076-TB, S60148-TB, S60149-TB, S60201-TB, S60243-TB, S60326-TB, S60338-TB, S60350-TB, S60361-TB, S60422-TB, S60440-TB, S60446-TB, S60505-TB, S60513-TB, S60519-TB, S60536-TB, S60552-TB, S60585-TB, S60630-TB, S60728-TB, S60812-TB, SAC1677, SAC1724, SAG1055, Satt040, Satt108, Satt109, Satt111, Satt176, Satt176, Satt219, Satt299, and Satt512 as enumerated Tables 3 through 12 are detected in a genomic sample of a soybean plant.

For example, in a breeding program designed to produce soybeans with increased yield in the Central United States growing region (e.g., exemplified by the growing conditions in Iowa), markers can be selected from the following set of markers: Satt642, Satt042, Satt364, Satt454, Satt526, Satt300, Satt591, Satt155, Satt385, Satt511, P12390B-1, Satt632-TB, Satt429, SAT.sub.--261, Satt197, P10641A-1, Satt556, Satt534, P10638B-2, Satt399. Satt361, P10639A-1, Satt661-TB, Satt190, SAT.sub.--311-DB, Satt338, Satt640-TB, Satt557, Satt319, SAT.sub.--142-DB, Satt460, Satt433, Satt357, Satt321, Satt295, Satt203, Satt507, Satt129, Satt147, SAT.sub.--351, P10621B-2, Satt558, Satt701, Satt634, Satt582, Satt389, Satt464, Satt662, Satt672, Satt573, Satt598, Satt263, Satt602, Satt151, SAT.sub.--273-DB, Satt146, Satt193, Satt569, Satt176, Satt343, Satt586, Satt040, Satt595, P10782A-1, Satt334, Satt144, Satt522, Satt570, Satt356, Satt533, Satt199, Satt517, Satt191, SAT.sub.--117, Satt279, Satt181, Satt127, Satt270, Satt292, SAG1223, SAC1699, SAT.sub.--065, Satt596, Satt406, Satt380, Satt183, Satt529, Satt242, Satt617, Satt240, SAT.sub.--301, Satt418, Satt398, Satt497, Satt166, Satt448, Satt373, Satt513, P12394A-1, SAG1048, Satt536, Satt175, Satt677, Satt680, P10615A-1, Satt551, Satt346, Satt336, SAT.sub.--330-DB, P13069A-1, P5467A-1, P5467A-2, SAT.sub.--084, SAT.sub.--275-DB, Satt660, Satt339, P12396A-1, Satt358, Satt487, Satt259, Satt420, Satt576, Satt633, Satt477, Satt581, Satt153, Satt243, P10793A-1, P12391A-1, P12392A-1, P13560A-1, P13561A-1, S60021-TB, S60048-TB, S60076-TB, S60148-TB, S60149-TB, S60201-TB, S60243-TB, S60326-TB, S60338-TB, S60350-TB, S60361-TB, S60422-TB, S60440-TB, S60446-TB, S60505-TB, S60513-TB, S60519-TB, S60536-TB, S60552-TB, S60585-TB, S60630-TB, S60728-TB, S60812-TB, SAC1677, SAC1724, SAG1055, Satt040, Satt111, Satt176, Satt219 and Satt299, such as: Satt684, Satt042, Satt364, Satt454, Satt526, Satt300, Satt591, Satt155, Satt385, Satt632-TB, Satt429, SAT-261, P10641A-1, Satt556, P1063813-2, Satt399, Satt361, Satt661-TB, Satt190, SAT.sub.--311-DB, Satt338, Satt640-TB, Satt557, Satt319, SAT.sub.--142-DB, Satt321, Satt203, Satt129, Satt147, SAT.sub.--351, P10621B-2, Satt701, Satt634, Satt582, Satt389, Satt464, Satt662, Satt672, Satt573, Satt598, Satt263, Satt151, SAT.sub.--273-DB, Satt146, Satt193, Satt569, Satt343, Satt586, Satt040, Satt595, Satt334, Satt144, Satt522, Satt570, Satt356, Satt199, Satt517, Satt191, Sat 117, Satt279, Satt181, Satt127, Satt270, Satt292, SAG1223, SAC1699, Sat 065, Satt596, Satt406, Satt380, Satt183, Satt529, Satt242, Satt617, Satt240, SAT.sub.--301, Satt418, Satt398, Satt497, Satt166, Satt448, Satt373, Satt513, P12394A-1, SAG1048, Satt536, Satt175, Satt677, Satt680, P10615A-1, Satt551, SAT.sub.--330-DB, P13069A-1, P5467A-1, P5467A-2, SAT.sub.--084, SAT.sub.--275-DB, Satt660, Satt339, Satt358, Satt487, Satt487, Satt420, Satt576, Satt633, Satt581, Satt153, Satt243, P10793A-1, P13560A-1, P13561A-1, S60021-TB, S60048-TB, S60076-TB, S60148-TB, S60149-TB, S60201-TB, S60243-TB, S60326-TB, S60338-TB, S60350-TB, S60361-TB, S60422-TB, S60440-TB, S60446-TB, S60505-TB, S60513-TB, S60519-TB, S60536-TB, S60552-TB, S60585-TB, S60630-TB, S60728-TB, S60812-TB, SAC1677, SAC1724, SAG1055, Satt111, Satt219 and Satt299. The following exemplary markers represent the best markers for selection for yield in the Central Region in each chromosome region: Satt684, Satt526, Satt591, Satt385, Satt632-TB, Satt429, SAT-261, P10641A-1, Satt556, P10638B-2, Satt190, SAT.sub.--31'-DB, Satt338, Satt640-TB, Satt557, SAT.sub.--142-DB, Satt321, Satt203, Satt129, SAT.sub.--351, Satt701, Satt582, Satt389, Satt464, Satt672, Satt598, Satt343, Satt595, Satt334, Satt144, Satt522, Satt570, Satt356, Satt199, Sat 117, Satt279, Satt181, Satt127, Satt270, Satt292, SAG1223, Sat 065, Satt529, Satt242, Satt617, SAT.sub.--301, Satt398, Satt497, Satt166, Satt373, SAG1048, Satt680, P10615A-1, SAT.sub.--330-DB, P13069A-1, SAT.sub.--275-DB, Satt339, Satt487, Satt420, Satt581 and Satt153. Comparable lists of markers can be compiled from Tables 3 through 12 at the discretion of the practitioner based on the desired growing region.

A soybean plant so identified can be utilized in a plant breeding program to develop lines with improved yield. Similarly, the detection of favorable (or conversely, non-favorable) allelic forms of the chromosome segments can be used to trace the flow of alleles in a soybean plant pedigree to ensure that the desired complement of alleles are included or excluded in the resulting soybean plant(s).

After a desired phenotype and a polymorphic chromosomal locus, e.g., a marker locus or QTL, are determined to segregate together (i.e., are determined to be in linkage disequilibrium), alleles corresponding to the desired phenotype are selected. In brief, a nucleic acid corresponding to the marker nucleic acid is detected in a biological sample from a plant to be selected. This detection can take the from of hybridization of a probe nucleic acid to a marker, e.g., using allele-specific hybridization, Southern analysis, northern analysis, in situ hybridization, hybridization of primers followed by PCR amplification of a product including the marker, or the like. A variety of procedures for detecting markers are described herein, e.g., in the section entitled "DETECTION OF MARKER LOCI." After the presence (or absence) of a particular marker in the biological sample is verified, the plant is selected and, optionally, crossed to produce progeny plants.

When a population is segregating for multiple loci affecting one or multiple traits, e.g., multiple loci involved in resistance to single disease, or multiple loci each involved in resistance to different diseases, the efficiency of MAS compared to phenotypic screening becomes even greater because all the loci can be processed in the lab together from a single sample of DNA. Thus, use of marker information for each of the traits in the breeding process is facilitated.

It will be appreciated that plants positive for a marker of the invention can be selected and crossed according to any breeding protocol relevant to the particular breeding program. Accordingly, progeny can be generated from a selected plant by crossing the selected plant to one or more additional plants selected on the basis of the same marker or a different marker, e.g., a different marker correlating with superior agronomic performance, or a different phentoype of interest, e.g., resistance to a particular disease. Alternatively, a selected plant can be back crossed to one or both parents. Backcrossing is usually done for the purpose of introgressing one or a few loci from a donor parent, e.g., a donor parent comprising exotic germplasm, into an otherwise desirable genetic background from the recurrent (typically, an elite) parent. The more cycles of backcrossing that are performed, the greater the genetic contribution of the recurrent parent to the resulting variety. A selected plant can also be outcrossed, e.g., to a plant or line not present in its genealogy. Such a plant can be selected from among a population subject to a prior round of analysis, or may be introduced into the breeding program de novo. A plant positive for a desired marker can also be self-crossed ("selfed") to create a true breeding line with the same genotype.

In some instances, even if a marker is close enough to a QTL to detect breeding bias, the marker may not be close enough for reliable MAS. If such a marker is far enough away from the QTL of interest, there may be crossing over between the marker and the QTL leading to repulsion phase linkages (in the elite population) between the marker allele that was originally linked in coupling to the favorable QTL allele. With time, the marker locus and the linked QTL locus could reach "linkage equilibrium" and this will prevent the use of that marker for reliable selection of the favorable QTL allele. For highly heritable traits, linkage phase between marker and QTL in any given parent can be easily determined through MAS followed by phenotypic characterization. However, linkage phase determination for traits of low heritability (e.g., yield) is much more difficult. In fact, the effects of single loci on yield may be extremely difficult to measure even with highly replicated field tests. In addition, if yield genes were highly heritable, the continuous selection for this trait would have "fixed" all of the favorable alleles quickly and yield progress would have previously reached a plateau. Since steady yield progress continues in soybean, it does not appear that a "yield plateau" has been reached yet (Specht et al., 1999, Crop Science 39:1560-1570). Therefore, many of the favorable alleles at the major yield loci in soybean are not yet fixed within the elite population. The question remains whether the existing marker loci are still in original linkage phase with the QTL loci. Fortunately, the results of breeding bias disclosed here can be used to solve the problem of "imperfect" yield gene markers several ways: a) linkage phase and QTL effect determination within specific crosses prior to MAS, b) use of flanking markers to predict which markers are still linked in coupling, and c) alternating cycles of MAS and phenotypic selection.

Linkage Phase and QTL Effect Determination within Specific Crosses:

Because elite soybean lines are highly related, a relatively small set of elite lines contains most of the favorable alleles that exist within the entire elite population. Therefore, determining the linkage phase between marker and QTL alleles at the loci identified as important for yield can be accomplished to further increase efficiency of MAS in the context of a soybean breeding program. Progeny from parents that are both high yielding and polymorphic for many of the target marker loci are assessed for yield in a small number of field locations. Using orthoganol comparisons, one locus at a time, predictions concerning correlations between marker alleles and phenotype can be made. For example if 40 random homozygous progeny from a cross that is segregating at 10 of the target loci are field tested, on average, 20 of the progeny will be homozygous for one of the parental alleles and 20 will be homozygous for the other parental allele. One can then pool the replicated yield data for lines containing the same marker allele and determine if the yield of said group is statistically different from the yield of lines containing the alternate marker allele. If so, then this marker should be effective for selection within that cross. This comparison is then done separately for each of the 10 segregating marker loci to determine which set of those 10 markers should be effective for selection within that cross.

Optionally, flanking markers can be used to predict which markers are linked in coupling. By comparing the genotype of flanking markers that are linked to the target marker in both elite lines and ancestors, one can predict which haplotypes have been most conserved during selection over many cycles. In the event that recombination has occurred between the target marker and the genetic element contributing to yield, such that the desired genetic element and the linked target marker locus are no longer in coupling linkage phase, flanking markers can be utilized to identify progeny with superior agronomic performance.

In addition, MAS and phenotypic selection can be alternated to insure that the allele in coupling phase is detected. Markers identified by breeding bias are employed for MAS as described above (with or without the advantages of linkage phase determination within specific crosses) and replicated yield testing is performed on selected progeny. If enough replicates and environments are sampled, a reasonable measure of yield phenotype can be obtained. Progeny that are confirmed as high yielding can be used as parents in the next cycle of MAS selection. By screening related populations according to this method, the population will move toward fixation of the favorable QTL alleles even if the favorable marker allele is not always in coupling with the QTL allele. Alternatively, residual polymorphisms at the marker loci described herein can be detected in near iso-genic lines, and the marker allele in corresponding to increased yield can be validated.

Introgression of Favorable Alleles

More Efficient Backcrossing of Specific Genes into Elite Lines

One application of MAS, in the context of the present invention is to use the "yield gene" markers to increase the efficiency of a introgression or backcrossing effort. In typical marker assisted backcrossing of a specific gene(s) from a donor source to an elite genetic background, one selects among backcross progeny for the donor trait and then uses markers to reconstitute as much of the elite background's genome as possible. Prior to the present invention, the markers used to identify the elite background were of unknown function, and many of the markers commonly used may be selecting for parts of the elite genome that do not actually contribute to high yield. Similarly, prior to the present invention, the major loci that contribute to yield were largely unknown, so the entire elite genome of the recurrent parent was selected for with the hopes of including all of the favorable alleles that it contained. However, the markers identified by breeding bias can be used to identify only those parts of the elite genome that are most significant with respect to yield. These markers can be used to concentrate backcrossing efforts on the most important parts of the elite genome. The fewer markers needed, the higher the probability of recapturing the elite phenotype quickly.

Thus, the markers and methods of the present invention can be utilized to guide marker assisted selection or breeding of soybean varieties with the desired complement (i.e., set) of allelic forms of chromosome segments associated with superior agronomic performance. Each of the disclosed alleles can be introduced into a soybean line via introgression, i.e., by means of traditional breeding (or introduced via transformation, or both) to yield a soybean plant with superior agronomic performance. The number of alleles associated with superior agronomic performance that can be introduced or be present in a soybean plant of the present invention ranges from 1 to the number of alleles disclosed herein, each integer of which is incorporated herein as if explicitly recited.

Exemplary soybean lines including at least one (and typically several or many) of the favorable allelic forms of the relevant chromosome segments are provided in Table 1. Without intent to limit the invention, these include the elite soybean lines: 90A07, 90B11, 90B31, 90B43, 90B72, 90B73, 91B01, 91B12, 91B33, 91B52, 91B53, 91B64, 91B91, 91B92, 92B05, 92B12, 92B23, 92B38, 92B63, 92B74, 92B75, 92B84, 92B95, 93B01, 93B11, 93B15, 93B25, 93B26, 93B41, 93B45, 93B46, 93B66, 93B67, 93B72, 93B82, 93B84, 93B85, 93B86, 93B87, 94B01, 94B23, 94B24, 94B53, 94B54, 94B73, 95B32, 95B33, 95B34, 95B53, 95B95, 95B96, 95B97, 96B21, 96B51, 97B52, 97B61, A1395, A2835, A2943, A3127, A3242, A3431, A4009, A4138, A4415, A4595, A4715, A5403, A5560, A5843, A5885, A5979, A5980, A6297, BEDFORD, CM428, CX105, CX232, CX253, CX289, CX394C, CX469C, D00566D362, ESSEX, EX04C00, EX06A00, EX10F01, EX13P01, EX13Q01, EX15N01, EX16N00, EX16P01, EX22Y01, EX22Z01, EX39E00, FORREST, G3362, HS93-4118, HUTCHESON, JIM, KORADA, M015733, M0400644-02, M0413735-11-52, M0501577-27-23, M0505469-61-89, MP39009, P1677, P9007, P9008, P9041, P9042, P9061, P9062, P9063, P9071, P9092, P9132, P9141, P9151, P9163, P9182, P9203, P9233, P9244, P9273, P9281, P9305, P9306, P9321, P9341, P9392, P9395, P9481, P9482, P9492, P9521, P9552, P9561, P9584, P9591, P9592, P9594, P9631, P9641, PHARAOH, RA451, R01154R002, S0066, S03W4, S0880, S1550, S1990, S19T9, S20F8, S22C3, S24L2, S25J5, S32Z3, S33N1, S38T8, S3911, S4260, S42H1, S43B5, S5960, S6189, S6262, ST0653, ST1073, ST1090, ST1970, ST2250, ST2488, ST2660, ST2688, ST2870, ST3171, ST3380, ST3630, ST3870, ST3883, TRACY, TRAILL, X9916, YB03E00, XB03F01, XB07E01, XB10D01, XB15M01, XB20M01, XB22R01, XB25W01, XB31C01, XB33B, XB34F01, XB35D, XB35W00, XB38A01, XB41M01, X842.100, XB42M01, XB48H01, XB54K01, XB55J01, XB58P99, XB63D00, XB67A00, YB03G01, YB08D01, YB09F01, YB09G01, YB10E01, YB11D01, YB14H01, YB15K99, YB21F01, YB21G01, YB22S00, YB22V01, YB22W01, YB22.times.01, YB24Z01, YB25R99, YB25.times.00, YB25Y01, YB25Z01, YB27.times.01, YB27Y01, YB28N01, YB29H01, YB29J01, YB30J01, YB30N01, YB30P01, YB31E01, YB32K01, YB33K01, YB34H01, YB35C01, YB36V00, YB39M01, YB40M01, YB40N01, YB41Q01, YB48L01, YB52J00, YB53E00, YB54H00, YB54J00, YB54L00, YB55H00, YB56E00, YB60N01, and YOUNG. These lines and progeny derived therefrom, as well as numerous additional elite lines, are conveniently utilized as breeding material to develop novel lines with increased numbers of favorable allelic forms of chromosome segments involved in yield.

The present invention also extends to a method of making a progeny soybean plant and these progeny soybean plants, per se. The method comprises crossing a first parent soybean plant with a second soybean plant and growing the female soybean plant under plant growth conditions to yield soybean plant progeny. Methods of crossing and growing soybean plants are well within the ability of those of ordinary skill in the art. Such soybean plant progeny can be assayed for the alleles associated with superior agronomic performance and, thereby, the desired progeny selected. Such progeny plants or seed can be sold commercially for soybean production, used for food, processed to obtain a desired constituent of the soybean, or further utilized in subsequent rounds of breeding. At least one of the first or second soybean plants is a soybean plant of the present invention in that it comprises at least one of the allelic forms of the present invention such that the progeny are capable of inheriting the allele. Conveniently, the first or second soybean plant line can be one of the elite lines of Table 1, or a derivative of such a line (i.e., a descendant or progenitor in that line's pedigree), or any relative of these elite lines (such as any elite line that was derived from the ancestors of these elite lines) that retains the same allelic form as that associated with superior agronomic performance. However, it will readily be recognized by one of skill in the art that following characterization essentially any elite line of soybean can be utilized.

Often, a method of the present invention is applied to at least one related soybean plant such as from progenitor or descendant lines in the subject soybean plants pedigree such that inheritance of the desired allele can be traced. The number of generations separating the soybean plants being subject to the method of the present invention will generally be from 1 to 20, commonly 1 to 5, and typically 1, 2, or 3 generations of separation, and quite often a direct descendant or parent of the soybean plant will be subject to the method (i.e., 1 generation of separation).

Incorporation of "Exotic" Germplasm while Maintaining Historical Progress

Genetic diversity is important for long term genetic gain in any breeding program. With limited diversity, genetic gain will eventually plateau when all of the favorable alleles have been fixed within the elite population. The challenge is to incorporate diversity into the elite pool without losing the genetic gain that has already been made and with the minimum possible investment. Breeding bias results provide an indication of which genomic regions and which favorable alleles from the original ancestors have been selected for and conserved over time, facilitating efforts to incorporate favorable variation from exotic germplasm sources (parents that are unrelated to the elite gene pool) in the hopes of finding favorable alleles that do not currently exist in the elite gene pool.

For example, the markers of the present invention can be used for MAS in crosses involving elite x exotic soybean lines by subjecting the segregating progeny to MAS to maintain the major yield alleles that have already been "fixed" by decades of selection and leave the rest of the genome open for contribution from the exotic sources. This would be a much more efficient system than conventional selection or MAS selection of elite alleles for which we have no prior information.

If the donor parent has polymorphic alleles at the elite target loci as well, the breeder can also relax the backcrossing selection intensity to allow variation at these loci to slip through. This provides the opportunity to see if an exotic line has something even more favorable than what was in the elite gene pool at the elite target loci.

The methods of the present invention also address another limitation of conventional backcrossing: that is, as the recurrent parent is reconstituted with increased cycles of backcrossing, potentially favorable alleles from the donor parent are excluded along with the unfavorable alleles from the donor parent. By selectively reconstituting the recurrent parent's genotype at the loci that have been shown by breeding bias to be important, one allows favorable alleles to be introduced from the donor parent at other loci. This allows for the donor parent to contribute exotic favorable alleles at loci that are not part of the elite "target genotype." This increases the chances of transgressive segregation while still retaining the most critical parts of the recurrent parent's genome. If the donor parent has polymorphic alleles at the elite target loci as well, the breeder can also relax the backcrossing selection intensity to allow variation at these loci to slip through and be tested in the context of a genome that is representative of the elite gene pool.

Detection of Marker Loci

Tables 3 through 12 provide a set of markers and favorable alleles associated with superior agronomic performance in a variety of geographic regions with a range of different growing environments. Each of the markers identifies a chromosome segment that includes one or more genetic elements, i.e., genes, that influences yield in soybeans. One of skill in the art will appreciate that the markers provided and discussed herein are merely exemplary and that numerous other linked markers can be identified based on genetic linkage and/or physical proximity on a chromosome to the markers provided herein. Thus, the compositions and methods of the present invention described herein are not intended to be limited only to the markers provided in Tables 3 through 12, but also include additional markers linked thereto. Additionally, while favorable alleles of the exemplary marker loci are disclosed herein, it will be readily appreciated by those of skill in the art, that favorable alleles of additional loci linked to the marker loci described herein can be determined without undue experimentation and employed in the compositions and methods of the present invention. Accordingly, any marker locus linked to the markers described herein, and localized to a chromosome segment identified by the markers of the invention, can also be used to identify that chromosome segment, and to define the genotype of a soybean plant, or to select for favorable allelic forms of a chromosome segment correlated with superior agronomic performance.

Although the specific DNA sequences which encode proteins are generally well-conserved across a species, regions of DNA which are non-coding, or which encode proteins or portions of proteins which lack critical function, tend to accumulate mutations, and therefore, are variable between members of the same species. Such regions provide the basis for numerous molecular genetic markers. Markers identify alterations in the genome, which can be insertions, deletions, point mutations, recombination events, or the presence and sequence of transposable elements. Many molecular or genetic markers have been characterized in plant species of interest, including soybean, and are known to those of skill in the art. For example, a collection of genetic markers for soybean is publicly available from Linkage Genetics (151 West 2200 South, Suite C, Salt Lake City, Utah 84119, 801-975-1188).

Molecular markers can be detected by numerous methods, well-established in the art (e.g., allele specific hybridization (ASH) or other methods for detecting single nucleotide polymorphisms (SNP), amplified fragment length polymorphisms (AFLP), amplified variable sequences, randomly amplified polymorphic DNA (RAPD), restriction fragment length polymorphisms (RFLP), self-sustained sequence replication, simple sequence repeat (SSR), single-strand conformation polymorphisms (SSCP), and isozyme markers). While the exemplary markers provided in Tables 3 through 12 are either SSR or SNP (ASH) markers, any of the aforementioned marker types can be employed in the context of the invention to identify chromosome segments encompassing genetic element that contribute to superior agronomic performance.

The majority of genetic markers rely on one or more property of nucleic acids for their detection. For example, some techniques for detecting genetic markers utilize hybridization of a probe nucleic acid to nucleic acids corresponding to the genetic marker. Hybridization formats including but not limited to, solution phase, solid phase, mixed phase, or in situ hybridization assays. Among the earliest markers detected, restriction fragment length polymorphisms (RFLP), are detected by hybridizing a probe which is typically a sub-fragment (or a synthetic oligonucleotide corresponding to a sub-fragment) of the nucleic acid to be detected to restriction digested genomic DNA. The restriction enzyme is selected to provide restriction fragments of at least two alternative (or polymorphic) lengths in different individuals, and will often vary from line to line. Determining a (one or more) restriction enzyme that produces informative fragments for each cross is a simple procedure, well known in the art. After separation by length in an appropriate matrix (e.g., agarose) and transfer to a membrane (e.g., nitrocellulose, nylon), the labeled probe is hybridized under conditions which result in equilibrium binding of the probe to the target followed by removal of excess probe by washing.

Nucleic acid probes to the marker loci can be cloned and/or synthesized. Detectable labels suitable for use with nucleic acid probes include any composition detectable by spectroscopic, radioisotopic, photochemical, biochemical, immunochemical, electrical, optical or chemical means. Useful labels include biotin for staining with labeled streptavidin conjugate, magnetic beads, fluorescent dyes, radiolabels, enzymes, and colorimetric labels. Other labels include ligands that bind to antibodies labeled with fluorophores, chemiluminescent agents, and enzymes. Labeling markers is readily achieved such as by the use of labeled PCR primers to marker loci.

The hybridized probe is then detected using, most typically by autoradiography or other similar detection technique (e.g., fluorography, liquid scintillation counter, etc.). Examples of specific hybridization protocols are widely available in the art, see, e.g., Berger, Sambrook, Ausubel, cited in the section entitled "GENERAL MOLECULAR BIOLOGY REFERENCES."

More specifically with respect to certain of the exemplary markers of the present invention, Allele-specific hybridization (ASH) technology is based on the stable annealing of a short, single-stranded, oligonucleotide probe to a completely complementary single-strand target nucleic acid. Detection is via an isotopic or non-isotopic label attached to the probe.

For each polymorphism, two or more different ASH probes are designed to have identical DNA sequences except at the polymorphic nucleotides of markers comprising a single nucleotide polymorphism (SNP). Each probe will have exact homology with one allele sequence so that the range of probes can distinguish all the known alternative allele sequences. Each probe is hybridized to the target DNA. With appropriate probe design and hybridization conditions, a single-base mismatch between the probe and target DNA will prevent hybridization. In this manner, only one of the alternative probes will hybridize to a target sample that is homozygous or homogenous for an allele. Samples that are heterozygous or heterogeneous for two alleles will hybridize to both of two alternative probes.

ASH markers are used as dominant markers where the presence or absence of only one allele is determined from hybridization or lack of hybridization by only one probe. The alternative allele may be inferred from the lack of hybridization. ASH probe and target molecules are optionally RNA or DNA; the target molecules are any length of nucleotides beyond the sequence that is complementary to the probe; the probe is designed to hybridize with either strand of a DNA target; the probe ranges in size to conform to variously stringent hybridization conditions, etc.

PCR allows the target sequence for ASH to be amplified from low concentrations of nucleic acid in relatively small volumes. Otherwise, the target sequence from genomic DNA is digested with a restriction endonuclease and size separated by gel electrophoresis. Hybridizations typically occur with the target sequence bound to the surface of a membrane or, as described in U.S. Pat. No. 5,468,613, which is incorporated by reference herein in its entirety for all purposes, the ASH probe sequence may be bound to a membrane.

In one embodiment, ASH data are obtained by amplifying nucleic acid fragments (amplicons) from genomic DNA using PCR, transferring the amplicon target DNA to a membrane in a dot-blot format, hybridizing a labeled oligonucleotide probe to the amplicon target, and observing the hybridization dots by autoradiography.

Other of the exemplary molecular markers provided herein are Simple sequence repeats (SSR). SSR markers take advantage of high levels of di-, tri-, or tetra-nucleotide tandem repeats within a genome. Dinucleotide repeats have been reported to occur in the human genome as many as 50,000 times with n varying from 10 to 60 or more (Jacob et al. (1991) Cell 67:213. Dinucleotide repeats have also been found in higher plants (Condit and Hubbell (1991) Genome 34:66).

Briefly, SSR data is generated by hybridizing primers to conserved regions of the plant genome which flank the SSR sequence. PCR is then used to amplify the dinucleotide repeats between the primers. The amplified sequences are then electorphoresed to determine the size and therefore the number of di-, tri-, and tetra-nucleotide repeats.

Amplified variable sequences refer to amplified sequences of the plant genome which exhibit high nucleic acid residue variability between members of the same species, e.g., microsatellite sequences. All organisms have variable genomic sequences and each organism (with the exception of a clone) has a different set of variable sequences. Once identified, the presence of specific variable sequences can be used to predict phenotypic traits. Preferably, DNA from the plant serves as a template for amplification with primers that flank a variable sequence of DNA. The variable sequence is amplified and then sequenced.

Randomly amplified polymorphic DNA (RAPD) markers are genomic sequences amplified by PCR using a single short primer of arbitrary sequence at low stringency. During amplification at low stringency a number of PCR products, some of which differ in length (and sequence) between individuals, are generated from random locations throughout the genome. Unlike amplified variable sequences, no prior sequence information is required to identify RAPD markers.

In vitro amplification techniques are well known in the art. Examples of techniques sufficient to direct persons of skill through such in vitro methods, including the polymerase chain reaction (PCR), the ligase chain reaction (LCR), Q.beta.-replicase amplification and other RNA polymerase mediated techniques (e.g., NASBA), are found in Berger, Sambrook and Ausubel as well as Mullis et al. (1987) U.S. Pat. No. 4,683,202, which is incorporated by reference herein in its entirety for all purposes; PCR Protocols, A Guide to Methods and Applications (Innis et al., eds.) Academic Press Inc., San Diego Academic Press Inc. San Diego, Calif. (1990) (Innis); Arnheim & Levinson (Oct. 1, 1990) C&EN 36-47; The Journal Of NIH Research (1991) 3, 81-94; (Kwoh et al. (1989) Proc. Natl. Acad. Sci. USA 86, 1173; Guatelli et al. (1990) Proc. Nat!. Acad. Sci. USA 87, 1874; Lomeli et al. (1989) J. Clin. Chem. 35, 1826; Landegren et al., (1988) Science 241, 1077-1080; Van Brunt (1990) Biotechnology 8, 291-294; Wu and Wallace, (1989) Gene 4, 560; Barringer et al. (1990) Gene 89, 117, and Sooknanan and Malek (1995) Biotechnology 13: 563-564. Improved methods of cloning in vitro amplified nucleic acids are described in Wallace et al., U.S. Pat. No. 5,426,039, which is incorporated by reference herein in its entirety for all purposes. Improved methods of amplifying large nucleic acids by PCR are summarized in Cheng et al. (1994)Nature 369: 684, and the references therein, in which PCR amplicons of up to 40 kb are generated. One of skill will appreciate that essentially any RNA can be converted into a double stranded DNA suitable for restriction digestion, PCR expansion and sequencing using reverse transcriptase and a polymerase. See, Ausubel, Sambrook and Berger.

Oligonucleotides for use as primers, e.g., in amplification reactions and for use as nucleic acid sequence probes are typically synthesized chemically according to the solid phase phosphoramidite triester method described by Beaucage and Caruthers (1981) Tetrahedron Lett. 22:1859, or can simply be ordered commercially.

Alternatively, self-sustained sequence replication can be used to identify genetic markers. Self-sustained sequence replication refers to a method of nucleic acid amplification using target nucleic acid sequences which are replicated exponentially in vitro under substantially isothermal conditions by using three enzymatic activities involved in retroviral replication: (1) reverse transcriptase, (2) Rnase H, and (3) a DNA-dependent RNA polymerase (Guatelli et al. (1990) Proc Natl Acad Sci USA 87:1874). By mimicking the retroviral strategy of RNA replication by means of cDNA intermediates, this reaction accumulates cDNA and RNA copies of the original target.

Amplified restriction fragment polymorphisms or amplified fragment length polymorphisms (AFLP) can also be used as genetic markers (Vos et al. (1995) Nucl Acids Res 23:4407. The phrase "amplified restriction fragment polymorphism" refers to selected restriction fragments, which are amplified before or after cleavage by a restriction endonuclease. The amplification step allows easier detection of specific restriction fragments. AFLP allows the detection large numbers of polymorphic markers and has been used for genetic mapping of plants (Becker et al. (1995) Mol Gen Genet 249:65; and Meksem et al. (1995) Mol Gen Genet 249:74.

Single nucleotide polymorphisms (SNP) are markers that consist of a shared sequence differentiated on the basis of a single nucleotide. Typically, this distinction is detected by differential migration patterns of an amplicon comprising the SNP on e.g., an acrylamide gel. In such cases the marker may also be referred to as a single-strand conformation polymorphism or SSCP. However, alternative modes of detection, such as hybridization, e.g., ASH, or RFLP analysis are not excluded.

Alternatively, isozyme markers are employed as genetic markers. Isozymes are multiple forms of enzymes that differ from one another in their amino acid, and therefore their nucleic acid sequences. Some isozymes are multimeric enzymes containing slightly different subunits. Other isozymes are either multimeric or monomeric but have been cleaved from the proenzyme at different sites in the amino acid sequence. Isozymes can be characterized and analyzed at the protein level, or alternatively, isozymes that differ at the nucleic acid level can be determined. In such cases any of the nucleic acid based methods described herein can be used to analyze isozyme markers.

In alternative embodiments, in silica methods can be used to detect the marker loci. For example, the sequence of a nucleic acid comprising the marker can be stored in a computer. The desired marker locus sequence or its homolog can be identified using an appropriate nucleic acid search algorithm as provided by, for example, in such readily available programs as BLAST.

Integrated Systems/Computer Assisted Methods

In some embodiments, the present invention includes an "integrated system" including an electronic means of storing or transmitting computer readable data representing or designating the allelic forms determined by the method of the present invention. The computer readable media includes cache, main, and storage memory and other electronic data storage means for storage of computer code. Data representing the allelic forms determined by the method of the present invention can also be electronically transmitted in a computer data signal embodied in a transmission medium over a network such as an intranet or interact or combinations thereof.

The phrase "integrated system" in the context of this invention refers to a system in which data entering a computer corresponds to physical objects or processes external to the computer, e.g., a marker allele, and a process that, within a computer, causes a physical transformation of the input signals to different output signals. In other words, the input data, e.g., amplification of a particular marker allele is transformed to output data, e.g., the identification of the allelic form of a chromosome segment. The process within the computer is a set of instructions, or "program," by which positive amplification or hybridization signals are recognized by the integrated system and attributed to individual samples as a genotype. Additional programs correlate the identity of individual samples with phenotypic values or marker alleles, e.g., statistical methods. In addition there are numerous e.g., C/C++ programs for computing, Delphi and/or Java programs for GUI interfaces, and productivity tools (e.g., Microsoft Excel and/or SigmaPlot) for charting. Other useful software tools in the context of the integrated systems of the invention include statistical packages such as SAS, Genstat, Matlab, Mathematica, and S-Plus and genetic modeling packages such as QU-GENE. Furthermore additional programming languages such as Fortran and the like are also suitably employed in the integrated systems of the invention.

For example, marker allele values assigned to a population of progeny descending from crosses between elite lines are recorded in a computer readable medium, thereby establishing a database corresponding allelic forms with unique identifiers for each member of the population of progeny. Any file or folder, whether custom-made or commercially available (e.g., from Oracle or Sybase) suitable for recording data in a computer readable medium is acceptable as a database in the context of the present invention. Data regarding genotype for one or more molecular markers, e.g., ASH, SSR, RFLP, RAPD, AFLP, SNP, isozyme markers or other markers as described herein, are similarly recorded in a computer accessible database. Optionally, marker data is obtained using an integrated system that automates one or more aspects of the assay (or assays) used to determine marker(s) genotype. In such a system, input data corresponding to genotypes for molecular markers are relayed from a device, e.g., an array, a scanner, a CCD, or other detection device directly to files in a computer readable medium accessible to the central processing unit. A set of instructions (embodied in one or more programs) encoding the statistical models of the invention is then executed by the computational device to identify correlations between yield data and marker genotypes. Typically, the integrated system also includes a user input device, such as a keyboard, a mouse, a touchscreen, or the like, for, e.g., selecting files, retrieving data, etc., and an output device (e.g., a monitor, a printer, etc.) for viewing or recovering the product of the statistical analysis.

Thus, in one aspect, the invention provides an integrated system comprising a computer or computer readable medium comprising set of files and/or a database with at least one data set that corresponds to genotypes for genetic markers. The system also includes a user interface allowing a user to selectively view one or more databases. In addition, standard text manipulation software such as word processing software (e.g., MICROSOFT.RTM. Word or COREL.RTM. WORDPERFECT.RTM.) and database or spreadsheet software (e.g., spreadsheet software such as MICROSOFT EXCEL.TM., COREL.RTM. QUATTRO PRO.RTM., or database programs such as MICROSOFT.RTM. ACCESS.RTM. or PARADOX.RTM.) can be used in conjunction with a user interface (e.g., a GUI in a standard operating system such as a WINDOWS.RTM., MACINTOSH.RTM., Unix or Linux system) to manipulate strings of characters.

The invention also provides integrated systems for sample manipulation incorporating robotic devices as previously described. A robotic liquid control armature for transferring solutions (e.g., plant cell extracts) from a source to a destination, e.g., from a microtiter plate to an array substrate, is optionally operably linked to the digital computer (or to an additional computer in the integrated system). An input device for entering data to the digital computer to control high throughput liquid transfer by the robotic liquid control armature and, optionally, to control transfer by the armature to the solid support is commonly a feature of the integrated system.

Integrated systems for molecular marker analysis of the present invention typically include a digital computer with one or more of high-throughput liquid control software, image analysis software, data interpretation software, a robotic liquid control armature for transferring solutions from a source to a destination operably linked to the digital computer, an input device (e.g., a computer keyboard) for entering data to the digital computer to control high throughput liquid transfer by the robotic liquid control armature and, optionally, an image scanner for digitizing label signals from labeled probes hybridized, e.g., to expression products on a solid support operably linked to the digital computer. The image scanner interfaces with the image analysis software to provide a measurement of, e.g., differentiating nucleic acid probe label intensity upon hybridization to an arrayed sample nucleic acid population, where the probe label intensity measurement is interpreted by the data interpretation software to show whether, and to what degree, the labeled probe hybridizes to a label. The data so derived is then correlated with sample identity, to determine the identity of a plant with a particular genotype(s) for genetic markers, e.g., to facilitate marker assisted selection of soybean plants with favorable allelic forms of chromosome segments involved in agronomic performance.

Optical images, e.g., hybridization patterns viewed (and, optionally, recorded) by a camera or other recording device (e.g., a photodiode and data storage device) are optionally further processed in any of the embodiments herein, e.g., by digitizing the image and/or storing and analyzing the image on a computer. A variety of commercially available peripheral equipment and software is available for digitizing, storing and analyzing a digitized video or digitized optical image, e.g., using PC (INTEL.RTM..times.86 or PENTIUM.RTM. chip-compatible MS-DOS.RTM., OS2.TM., WINDOWS.RTM., WINDOWS.RTM. NT or WINDOWS.RTM.95 based machines), MACINTOSH.RTM., LINUX, or UNIX based (e.g., SUN.TM. work station) computers.

Identification of Additional Markers and QTL Associated with Yield

Nucleic acids isolated from the chromosome segments of the present invention, e.g., nucleic acids corresponding to additional marker loci, nucleic acids corresponding to genetic elements contributing to superior agronomic performance, are within the scope of the present invention. For example, in the rare instance in which the markers and alleles of the present invention are not well suited for MAS, the markers can, nonetheless, be used to identify additional linked markers that are, e.g., closer to, or within, the QTL of interest. Based on the markers disclosed herein, improvement in the efficiency of MAS can be obtained by saturating the relevant chromosome segments with numerous linked markers. The breeding bias analysis can be repeated on all markers within the region to identify those having the highest statistical significance. MAS can be practiced with all markers in the region followed by phenotypic characterization (i.e., of yield) to determine which markers are most efficient.

Additional markers can be identified in a variety of ways. For example, additional markers can be identified by evaluating publicly or privately available markers that have been mapped to the genomic region(s) of interest, including candidate markers known to encode proteins that are, at least theoretically, likely to be related to yield. Alternatively, unmapped markers can be evaluated to determine which markers map to the same genomic region via independent mapping studies.

A theoretically optimal marker can be obtained by isolating genetic elements contributing to superior agronomic performance, such as coding regions giving rise to expression products that influence yield. Identification of a QTL underlying superior agronomic performance can be accomplished by anchoring the marker to a physical DNA map and then progressing upstream and downstream to identify coding sequences, i.e., by "positional gene cloning."

Positional gene cloning uses the physical proximity of a genetic marker (such as a marker provided in Tables 3 through 12) to identify a cloned chromosomal fragment that includes a nucleic acid of interest, e.g., a QTL contributing to superior agronomic performance. Clones of nucleic acids linked to the markers of the invention have a variety of uses, including as additional genetic markers to define the chromosome segments of the invention and for use in marker assisted selection (MAS). Markers which are adjacent to an open reading frame (ORF) can hybridize to a DNA clone, thereby identifying a clone on which an ORE associated with a trait contributing to yield is located. If the marker is more distant, a fragment containing the open reading frame is identified by successive rounds of screening and isolation of clones which together comprise a contiguous sequence of DNA, a "contig." Protocols sufficient to guide one of skill through the isolation of clones associated with linked markers are found in, e.g., in the references cited in the section entitled "GENERAL MOLECULAR BIOLOGY REFERENCES" below.

An isolated chromosome fragment can be produced by such well known methods as digesting chromosomal DNA with one or more restriction enzymes, or by amplifying a chromosomal region in a polymerase chain reaction (PCR), or alternative amplification reaction. The digested or amplified fragment is typically ligated into a vector suitable for replication, e.g., a plasmid, a cosmid, a phage, an artificial chromosome, or the like, and, optionally expression, of the inserted fragment.

Such chromosome segments can be utilized to identify homologous nucleic acids, e.g., in other lines or species, and/or can be used in the production of transgenic plants with desirable phenotypic attributes related to agronomic performance. A chromosome segment comprising a nucleic acid contributing to increased yield is isolated, e.g., cloned via positional cloning methods outlined above. A chromosome segment can contain one or more ORFs associated with the desired phenotypic trait, and can be cloned on one or more individual vectors, e.g., depending on the size of the chromosome interval.

It will be appreciated that numerous vectors are available in the art for the isolation and replication of the nucleic acids of the invention. For example, plasmids, cosmids and phage vectors are well known in the art, and are sufficient for many applications (e.g., in applications involving insertion of nucleic acids ranging from less than 1 to about 20 kilobases (kb). In certain applications, it is advantageous to make or clone large nucleic acids to identify nucleic acids more distantly linked to a given marker, or to isolate nucleic acids in excess of 10-20 kb, e.g., up to several hundred kilobases or more, such as the entire interval between two linked markers, i.e., up to and including one or more centimorgans (CM), linked to markers as identified herein. In such cases, a number of vectors capable of accommodating large nucleic acids are available in the art, these include, yeast artificial chromosomes (YACs), bacterial artificial chromosomes (BACs), plant artificial chromosomes (PACs) and the like. For a general introduction to YACs, BACs, PACs and MACs as artificial chromosomes, see, e.g., Monaco and Larin (1994) Trends Biotechnol 12:280. In addition, methods for the in vitro amplification of large nucleic acids linked to genetic markers are widely available (e.g., Cheng et al. (1994) Nature 369:684, and references therein). Cloning systems can be created or obtained from commercially; see, for example, Stratagene (La Jolla, Calif.).

Vectors, Promoters and Expression Systems

The present invention includes recombinant constructs incorporating one or more of the nucleic acid sequences described above. Such constructs include a vector, for example, a plasmid, a cosmid, a phage, a virus, a bacterial artificial chromosome (BAC), a yeast artificial chromosome (YAC), etc., into which one or more polynucleotide sequences of interest (e.g., a marker or genetic element contributing to yield) has been inserted, in a forward or reverse orientation. For example, the inserted nucleic acid can include a chromosomal sequence or cDNA including a all or part of at least one genetic element or open reading frame ("ORF") associated with yield. In a preferred embodiment, the construct further comprises regulatory sequences, including, for example, a promoter, operably linked to the sequence. Large numbers of suitable vectors and promoters are known to those of skill in the art, and are commercially available.

As desired, the polynucleotides of the present invention, e.g., a genetic element contributing to superior agronomic performance identified according to the methods described herein, can be included in any one of a variety of vectors suitable for generating sense or antisense RNA, and optionally, polypeptide expression products. Such vectors include chromosomal, nonchromosomal and synthetic DNA sequences, e.g., derivatives of SV40; bacterial plasmids; phage DNA; baculovirus; yeast plasmids; vectors derived from combinations of plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox virus, pseudorabies, adenovirus, adeno-associated virus, retroviruses and many others. Any vector that is capable of introducing genetic material into a cell, and, if replication is desired, which is replicable in the relevant host can be used.

In an expression vector or expression cassette, the polynucleotide sequence of interest is physically arranged in proximity and orientation to an appropriate transcription control sequence (promoter, and optionally, one or more enhancers) to direct mRNA synthesis. That is, the polynucleotide sequence of interest is "operably linked" to an appropriate transcription control sequence. Examples of such promoters include: LTR or SV40 promoter, E. coli lac or trp promoter, phage lambda P.sub.L promoter, and other promoters known to control expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also contains a ribosome binding site for translation initiation, and a transcription terminator. The vector optionally includes appropriate sequences for amplifying expression. In addition, the expression vectors optionally comprise one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells, such as dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, or such as tetracycline or ampicillin resistance in E. coli.

Additional Expression Elements

Where translation of polypeptide encoded by a nucleic acid comprising a polynucleotide sequence of the invention is desired, additional translation specific initiation signals can improve the efficiency of translation. These signals can include, e.g., an ATG initiation codon and adjacent sequences. In some cases, for example, full-length cDNA molecules or chromosomal segments including a coding sequence incorporating, e.g., a QTL or an ORF associated with a QTL or QTL marker, a translation initiation codon and associated sequence elements are inserted into the appropriate expression vector simultaneously with the polynucleotide sequence of interest. In such cases, additional translational control signals frequently are not required. However, in cases where only a polypeptide coding sequence, or a portion thereof, is inserted, exogenous translational control signals, including an ATG initiation codon must be provided. Furthermore, the initiation codon must be in the correct reading frame to ensure transcription of the polynucleotide sequence of interest. Exogenous transcriptional elements and initiation codons can be of various origins, both natural and synthetic. The efficiency of expression can be enhanced by the inclusion of enhancers appropriate to the cell system in use (Scharf D et al. (1994) Results Probl Cell Differ 20:125-62; Bittner et al. (1987) Methods in Enzymol 153:516-544).

Generation of Transgenic Plants and Cells

The present invention also relates to host cells and organisms which are transformed with nucleic acids corresponding to genetic elements contributing to superior agronomic performance and other genes identified according to the methods of the invention. For example, such nucleic acids include chromosome segments, ORFs, and/or cDNAs or corresponding to a sequence or subsequence included within the identified chromosome segment or ORF. Additionally, the invention provides for the production of polypeptides corresponding to such genetic elements by recombinant nucleic acid (and expression) techniques. Host cells are genetically engineered (i.e., transduced, transfected or transformed) with the vectors of this invention (i.e., vectors incorporating genetic elements contributing to increased yield, or other nucleic acids identified according to the methods of the invention and as described above) which are, for example, a cloning vector or an expression vector. Such vectors include, in addition to those described above, e.g., an agrobacterium, a virus (such as a plant virus), a naked polynucleotide, or a conjugated polynucleotide. The vectors are introduced into plant tissues, cultured plant cells or plant protoplasts by a variety of standard methods including electroporation (From et al. (1985) Proc. Natl. Acad. Sci. USA 82; 5824), infection by viral vectors such as cauliflower mosaic virus (CaMV) (Hohn et al. (1982) Molecular Biology of Plant Tumors (Academic Press, New York, pp. 549-560; Howell U.S. Pat. No. 4,407,956), high velocity ballistic penetration by small particles with the nucleic acid either within the matrix of small beads or particles, or on the surface (Klein et al. (1987) Nature 327; 70), use of pollen as vector (WO 85/01856), or use of Agrobacterium tumefaciens or A. rhizogenes carrying a T-DNA plasmid in which DNA fragments are cloned. The T-DNA plasmid is transmitted to plant cells upon infection by Agrobacterium tumefaciens, and a portion is stably integrated into the plant genome (Horsch et al. (1984) Science 233; 496; Fraley et al. (1983) Proc. Natl. Acad. Sci. USA 80; 4803). The method of introducing a nucleic acid of the present invention into a host cell is not critical to the instant invention. Thus, any method, e.g., including but not limited to the above examples, which provides for effective introduction of a nucleic acid into a cell or protoplast can be employed.

The engineered host cells can be cultured in conventional nutrient media modified as appropriate for such activities as, for example, activating promoters or selecting transformants. These cells can optionally be cultured into transgenic plants. Plant regeneration from cultured protoplasts is described in Evans et al. (1983) "Protoplast Isolation and Culture," Handbook of Plant Cell Cultures 1, 124-176 (MacMillan Publishing Co., New York; Davey (1983) "Recent Developments in the Culture and Regeneration of Plant Protoplasts," Protoplasts, pp. 12-29, (Birkhauser, Basel); Dale (1983) "Protoplast Culture and Plant Regeneration of Cereals and Other Recalcitrant Crops," Protoplasts pp. 31-41, (Birkhauser, Basel); Binding (1985) "Regeneration of Plants," Plant Protoplasts, pp. 21-73, (CRC Press, Boca Raton,).

The present invention also relates to the production of transgenic organisms, which may be bacteria, yeast, fungi, or plants, transduced with the nucleic acids, e.g., cloned QTL of the invention. A thorough discussion of techniques relevant to bacteria, unicellular eukaryotes and cell culture may be found in references enumerated above and are briefly outlined as follows. Several well-known methods of introducing target nucleic acids into bacterial cells are available, any of which may be used in the present invention. These include: fusion of the recipient cells with bacterial protoplasts containing the DNA, treatment of the cells with liposomes containing the DNA, electroporation, projectile bombardment (biolistics), carbon fiber delivery, and infection with viral vectors (discussed further, below), etc. Bacterial cells can be used to amplify the number of plasmids containing DNA constructs of this invention. The bacteria are grown to log phase and the plasmids within the bacteria can be isolated by a variety of methods known in the art (see, for instance, Sambrook). In addition, numerous kits are commercially available and can be employed according to the manufacturers instructions for the purification of plasmids from bacteria (and other cells). For their proper use, follow the manufacturer's instructions (see, for example, EASYPREP.TM., FLEXIPREP.RTM., both from Pharmacia Biotech; STRATACLEAN.RTM., from Stratagene; and, QIAPREP.RTM. from Qiagen). The isolated and purified plasmids are then further manipulated to produce other plasmids, used to transfect plant cells or incorporated into Agrobacterium tumefaciens related vectors to infect plants. Typical vectors contain transcription and translation terminators, transcription and translation initiation sequences, and promoters useful for regulation of the expression of the particular target nucleic acid. The vectors optionally comprise generic expression cassettes containing at least one independent terminator sequence, sequences permitting replication of the cassette in eukaryotes, or prokaryotes, or both, (e.g., shuttle vectors) and selection markers for both prokaryotic and eukaryotic systems. Vectors are suitable for replication and integration in prokaryotes, eukaryotes, or preferably both. See, Gillman & Smith (1979) Gene 8:81; Roberts et al. (1987) Nature 328:731; Schneider et al. (1995) Protein Expr. Purif 6435; 10; Ausubel, Sambrook, Berger (all supra). A catalogue of Bacteria and Bacteriophages useful for cloning is provided, e.g., by the ATCC, e.g., The ATCC Catalogue of Bacteria and Bacteriophage (1992) Gherna et al. (eds) published by the ATCC. Additional basic procedures for sequencing, cloning and other aspects of molecular biology and underlying theoretical considerations are also found in Watson at al. (1992). Recombinant DNA, Second Edition, Scientific American Books, NY.

Transforming Nucleic Acids into Plants.

Embodiments of the present invention pertain to the production of transgenic plants comprising the cloned nucleic acids, e.g., chromosome segments, isolated ORFs, and cDNAs associated with genetic elements identified by their proximity to the markers of the invention. Techniques for transforming plant cells with nucleic acids are generally available and can be adapted to the invention by the use of nucleic acids encoding or corresponding to chromosome segments, subsequences, e.g., ORFs, and the like. In addition to Berger, Ausubel and Sambrook (infra), useful general references for plant cell cloning, culture and regeneration include Jones (ed) (1995) Plant Gene Transfer and Expression Protocols--Methods in Molecular Biology, Volume 49 Humana Press Towata N.J.; Payne et al. (1992) Plant Cell and Tissue Culture in Liquid Systems John Wiley & Sons, Inc. New York, N.Y. (Payne); and Gamborg and Phillips (eds) (1995) Plant Cell, Tissue and Organ Culture; Fundamental Methods Springer Lab Manual, Springer-Verlag (Berlin Heidelberg New York) (Gamborg). A variety of cell culture media are described in Atlas and Parks (eds) The Handbook of Microbiological Media (1993) CRC Press, Boca Raton, Fla. (Atlas). Additional information for plant cell culture is found in available commercial literature such as the Life Science Research Cell Culture Catalogue (1998) from Sigma-Aldrich, Inc (St Louis, Mo.) (Sigma-LSRCCC) and, e.g., the Plant Culture Catalogue and supplement (1997) also from Sigma-Aldrich, Inc (St. Louis, Mo.) (Sigma-PCCS). Additional details regarding plant cell culture are found in Croy, (ed.) (1993) Plant Molecular Biology Bios Scientific Publishers, Oxford, U.K.

The nucleic acid constructs of the invention, e.g., plasmids, cosmids, artificial chromosomes, DNA and RNA polynucleotides, are introduced into plant cells, either in culture or in the organs of a plant by a variety of conventional techniques. Where the sequence is expressed, the sequence is optionally combined with transcriptional and translational initiation regulatory sequences which direct the transcription or translation of the sequence from the exogenous DNA in the intended tissues of the transformed plant.

Isolated nucleic acids can be introduced into plants according to any of a variety of techniques known in the art. Techniques for transforming a wide variety of higher plant species are well known and described in the technical, scientific, and patent literature. See, for example, Weising et al. (1988) Ann. Rev. Genet. 22:421-477.

For example plasmids, cosmids, phage, naked or variously conjugated-DNA polynucleotides, (e.g., polylysine-conjugated DNA, peptide-conjugated DNA, liposome-conjugated DNA, etc.), or artificial chromosomes, can be introduced directly into the genomic DNA of the plant cell using techniques such as electroporation and microinjection of plant cell protoplasts, or the DNA constructs can be introduced directly to plant cells using ballistic methods, such as DNA particle bombardment.

Microinjection techniques for injecting e.g., cells, embryos, callus and protoplasts, are known in the art and well described in the scientific and patent literature. For example, a number of methods are described in Jones (ed) (1995) Plant Gene Transfer and Expression Protocols--Methods in Molecular Biology, Volume 49 Humana Press Towata N.J., as well as in the other references noted herein and available in the literature.

For example, the introduction of DNA constructs using polyethylene glycol precipitation is described in Paszkowski, et al., EMBO J. 3:2717 (1984). Electroporation techniques are described in Fromm, et al., Proc. Nat'l. Acad. Sci. USA 82:5824 (1985). Ballistic transformation techniques are described in Klein, et al., Nature 327:70-73 (1987). Additional details are found in Jones (1995) and Gamborg and Phillips (1995), supra, and in U.S. Pat. No. 5,990,387, which is incorporated by reference herein in its entirety for all purposes.

Alternatively, and in some cases preferably, Agrobacterium mediated transformation is employed to generate transgenic plants. Agrobacterium-mediated transformation techniques, including disarming and use of binary vectors, are also well described in the scientific literature. See, for example Horsch, et al. (1984) Science 233:496; and Fraley et al. (1984) Proc. Nat'l. Acad. Sci. USA 80:4803 and recently reviewed in Hansen and Chilton (1998) Current Topics in Microbiology 240:22 and Das (1998) Subcellular Biochemistry 29: Plant Microbe Interactions pp 343-363.

The DNA constructs may be combined with suitable T-DNA flanking regions and introduced into a conventional Agrobacterium tumefaciens host vector. The virulence functions of the Agrobacterium tumefaciens host will direct the insertion of the construct and adjacent marker into the plant cell DNA when the cell is infected by the bacteria. See, U.S. Pat. No. 5,591,616, which is incorporated by reference herein in its entirety for all purposes. Although Agrobacterium is useful primarily in dicots, certain monocots can be transformed by Agrobacterium. For instance, Agrobacterium transformation of maize is described in U.S. Pat. No. 5,550,318, which is incorporated by reference herein in its entirety for all purposes.

Other methods of transfection or transformation include (I) Agrobacterium rhizogenes-mediated transformation (see, e.g., Lichtenstein and Fuller (1987) In: Genetic Engineering, vol. 6, P W J Rigby, Ed., London, Academic Press; and Lichtenstein; C. P., and Draper (1985) In: DNA Cloning, Vol. II, D. M. Glover, Ed., Oxford, IRI Press; WO 88/02405, published Apr. 7, 1988, describes the use of A. rhizogenes strain A4 and its Ri plasmid along with A. tumefaciens vectors pARC8 or pARC16 (2) liposome-mediated DNA uptake (see, e.g., Freeman et al. (1984) Plant Cell Physiol. 25:1353), (3) the vortexing method (see, e.g., Kindle (1990) Proc. Natl. Acad. Sci., (USA) 87:1228.

DNA can also be introduced into plants by direct DNA transfer into pollen as described by Zhou et al. (1983) Methods in Enzymology, 101:433; D. Hess (1987) Intern Rev. Cytol. 107:367; Luo et al. (1988) Plant Mol. Biol. Reporter 6:165. Expression of polypeptide coding genes can be obtained by injection of the DNA into reproductive organs of a plant as described by Pena et al. (1987) Nature 325:274. DNA can also be injected directly into the cells of immature embryos and the desiccated embryos rehydrated as described by Neuhaus et al. (1987) Theor. Appl. Genet. 75:30; and Benbrook et al. (1986) in Proceedings Bio Expo Butterworth, Stoneham, Mass., pp. 27-54. Additionally, a variety of plant viruses that can be employed as vectors are known in the art and include cauliflower mosaic virus (CaMV), geminivirus, brome mosaic virus, and tobacco mosaic virus.

Regeneration of Transgenic Plants

Transformed plant cells which are derived by any of the above transformation techniques can be cultured to regenerate a whole plant which possesses the transformed genotype and thus the desired phenotype. Such regeneration techniques rely on manipulation of certain phytohormones in a tissue culture growth medium, typically relying on a biocide and/or herbicide marker which has been introduced together with the desired nucleotide sequences. Plant regeneration from cultured protoplasts is described in Evans et al. (1983) Protoplasts Isolation and Culture, Handbook of Plant Cell Culture pp. 124-176, Macmillian Publishing Company, New York; and Binding (1985) Regeneration of Plants, Plant Protoplasts pp. 21-73, CRC Press, Boca Raton. Regeneration can also be obtained from plant callus, explants, somatic embryos (Dandekar et al. (1989) J. Tissue Cult. Meth. 12:145; McGranahan, et al. (1990) Plant Cell Rep. 8:512) organs, or parts thereof. Such regeneration techniques are described generally in Klee et al. (1987)., Ann. Rev. of Plant Phys. 38:467-486. Additional details are found in Payne (1992) and Jones (1995), both supra, and Weissbach and Weissbach, eds. (1988) Methods for Plant Molecular Biology Academic Press, Inc., San Diego, Calif. This regeneration and growth process includes the steps of selection of transformant cells and shoots, rooting the transformant shoots and growth of the plantlets in soil. These methods are adapted to the invention to produce transgenic plants bearing QTLs and other genes isolated according to the methods of the invention.

In addition, the regeneration of plants containing the polynucleotide of the present invention and introduced by Agrobacterium into cells of leaf explants can be achieved as described by Horsch et al. (1985) Science 227:1229-1231. In this procedure, transformants are grown in the presence of a selection agent and in a medium that induces the regeneration of shoots in the plant species being transformed as described by Fraley et al. (1983) Proc. Natl. Acad. Sci. (U.S.A.) 80:4803. This procedure typically produces shoots within two to four weeks and these transformant shoots are then transferred to an appropriate root-inducing medium containing the selective agent and an antibiotic to prevent bacterial growth. Transgenic plants of the present invention may be fertile or sterile.

In construction of recombinant expression cassettes of the invention, which include, for example, an ORF associated with a marker or genetic element contributing to yield, a plant promoter fragment is optionally employed which directs expression of a nucleic acid in any or all tissues of a regenerated plant. Examples of constitutive promoters include the cauliflower mosaic virus (CaMV) 35S transcription initiation region, the 1'- or 2'-promoter derived from T-DNA of Agrobacterium tumefaciens, and other transcription initiation regions from various plant genes known to those of skill. Alternatively, the plant promoter may direct expression of the polynucleotide of the invention in a specific tissue (tissue-specific promoters) or may be otherwise under more precise environmental control (inducible promoters). Examples of tissue-specific promoters under developmental control include promoters that initiate transcription only in certain tissues, such as fruit, seeds, or flowers.

Any of a number of promoters which direct transcription in plant cells can be suitable. The promoter can be either constitutive or inducible. In addition to the promoters noted above, promoters of bacterial origin which operate in plants include the octopine synthase promoter, the nopaline synthase promoter and other promoters derived from native Ti plasmids. See, Herrara-Estrella et al. (1983), Nature, 303:209. Viral promoters include the 35S and 19S RNA promoters of cauliflower mosaic virus. See, Odell et al. (1985) Nature, 313:810. Other plant promoters include the ribulose-1,3-bisphosphate carboxylase small subunit promoter and the phaseolin promoter. The promoter sequence from the E8 gene and other genes may also be used. The isolation and sequence of the E8 promoter is described in detail in Deikman and Fischer (1988) EMBO J. 7:3315. Many other promoters are in current use and can be coupled to an exogenous DNA sequence to direct expression of the nucleic acid.

If expression of a polypeptide, including those encoded by QTL or other nucleic acid, is desired, a polyadenylation region at the 3'-end of the coding region is typically included. The polyadenylation region can be derived from the natural gene, from a variety of other plant genes, or from, e.g., T-DNA.

The vector comprising the sequences (e.g., promoters or coding regions) from genes encoding expression products and transgenes of the invention will typically include a nucleic acid subsequence, a marker gene which confers a selectable, or alternatively, a screenable, phenotype on plant cells. For example, the marker may encode biocide tolerance, particularly antibiotic tolerance, such as tolerance to kanamycin, G418, bleomycin, hygromycin, or herbicide tolerance, such as tolerance to chlorosluforon, or phosphinothricin (the active ingredient in the herbicides bialaphos or Basta). See, e.g., Padgette et al. (1996) In: Herbicide-Resistant Crops (Duke, ed.), pp 53-84, CRC Lewis Publishers, Boca Raton ("Padgette, 1996"). For example, crop selectivity to specific herbicides can be conferred by engineering genes into crops which encode appropriate herbicide metabolizing enzymes from other organisms, such as microbes. See, Vasil (1996) In: Herbicide-Resistant Crops (Duke, ed.), pp 85-91, CRC Lewis Publishers, Boca Raton) ("Vasil", 1996).

One of skill will recognize that after the recombinant expression cassette is stably incorporated in transgenic plants and confirmed to be operable, it can be introduced into other plants by sexual crossing. Any of a number of standard breeding techniques can be used, depending upon the species to be crossed. In vegetatively propagated crops, mature transgenic plants can be propagated by the taking of cuttings or by tissue culture techniques to produce multiple identical plants. Selection of desirable transgenics is made and new varieties are obtained and propagated vegetatively for commercial use. In seed propagated crops, mature transgenic plants can be self crossed to produce a homozygous inbred plant. The inbred plant produces seed containing the newly introduced heterologous nucleic acid. These seeds can be grown to produce plants that would produce the selected phenotype. Parts obtained from the regenerated plant, such as flowers, seeds, leaves, branches, fruit, and the like are included in the invention, provided that these parts comprise cells comprising the isolated nucleic acid of the present invention. Progeny and variants, and mutants of the regenerated plants are also included within the scope of the invention, provided that these parts comprise the introduced nucleic acid sequences.

Transgenic plants expressing a polynucleotide of the present invention can be screened for transmission of the nucleic acid of the present invention by, for example, standard immunoblot and DNA detection techniques. Expression at the RNA level can be determined initially to identify and quantitate expression-positive plants. Standard techniques for RNA analysis can be employed and include PCR amplification assays using oligonucleotide primers designed to amplify only the heterologous RNA templates and solution hybridization assays using heterologous nucleic acid-specific probes. The RNA-positive plants can then analyzed for protein expression by Western immunoblot analysis using the specifically reactive antibodies of the present invention. In addition, in situ hybridization and immunocytochemistry according to standard protocols can be done using heterologous nucleic acid specific polynucleotide probes and antibodies, respectively, to localize sites of expression within transgenic tissue. Generally, a number of transgenic lines are usually screened for the incorporated nucleic acid to identify and select plants with the most appropriate expression profiles.

A preferred embodiment is a transgenic plant that is homozygous for the added heterologous nucleic acid; i.e., a transgenic plant that contains two added nucleic acid sequences, one gene at the same locus on each chromosome of a chromosome pair. A homozygous transgenic plant can be obtained by sexually mating (selfing) a heterozygous transgenic plant that contains a single added heterologous nucleic acid, germinating some of the seed produced and analyzing the resulting plants produced for altered expression of a polynucleotide of the present invention relative to a control plant (i.e., native, non-transgenic). Back-crossing to a parental plant and out-crossing with a non-transgenic plant are also contemplated.

General Molecular Biology References

In the context of the invention, e.g., identifying, monitoring and/or cloning molecular markers and/or other loci, nucleic acids and/or proteins are manipulated according to well known molecular biology techniques. Detailed protocols for numerous such procedures are described in, e.g., in Ausubel et al. Current Protocols in Molecular Biology (supplemented through 2000) John Wiley & Sons, New York ("Ausubel"); Sambrook et al. Molecular Cloning--A Laboratory Manual (2nd Ed.), Vol. 1-3, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1989 ("Sambrook"), and Berger and Kimmel Guide to Molecular Cloning Techniques, Methods in Enzymology volume 152 Academic Press, Inc., San Diego, Calif. ("Berger").

In addition to the above references, protocols for in vitro amplification techniques, such as the polymerase chain reaction (PCR), the ligase chain reaction (LCR), Q.beta.-replicase amplification, and other RNA polymerase mediated techniques (e.g., NASBA), useful e.g., for amplifying cDNA probes of the invention, are found in Mullis et al. (1987) U.S. Pat. No. 4,683,202; PCR Protocols A Guide to Methods and Applications (Innis et al. eds) Academic Press Inc. San Diego, Calif. (1990) ("Innis"); Arnheim and Levinson (1990) C&EN 36; The Journal Of NIH Research (1991) 3:81; Kwoh et al. (1989) Proc Natl Acad Sci USA 86, 1173; Guatelli et al. (1990) Proc Natl Acad Sci USA 87:1874; Lomeli et al. (1989) J Clin Chem 35:1826; Landegren et al. (1988) Science 241:1077; Van Brunt (1990) Biotechnology 8:291; Wu and Wallace (1989) Gene 4: 560; Barringer et al. (1990) Gene 89:117, and Sooknanan and Malek (1995) Biotechnology 13:563. Additional methods, useful for cloning nucleic acids in the context of the present invention, include Wallace et al. U.S. Pat. No. 5,426,039. Improved methods of amplifying large nucleic acids by PCR are summarized in Cheng et al. (1994) Nature 369:684 and the references therein.

Certain polynucleotides of the invention, e.g., oligonucleotides can be synthesized utilizing various solid-phase strategies involving mononucleotide- and/or trinucleotide-based phosphoramidite coupling chemistry. For example, nucleic acid sequences can be synthesized by the sequential addition of activated monomers and/or trimers to an elongating polynucleotide chain. See e.g., Caruthers, M. H. et al. (1992) Meth Enzymol 211:3.

In lieu of synthesizing the desired sequences, essentially any nucleic acid can be custom ordered from any of a variety of commercial sources, such as The Midland Certified Reagent Company, The Great American Gene Company, ExpressGen, Inc., Operon Technologies, Inc., and many others.

Similarly, commercial sources for nucleic acid and protein microarrays are available, and include, e.g., Affymetrix, Santa Clara, Calif.; and Incyte, Palo Alto, Calif.; and Ciphergen Biosciences, Fremont, Calif.

High Throughput Screening

In one aspect of the invention, the determination of genetic marker alleles is performed by high throughput screening. High throughput screening involves providing a library of genetic markers, e.g., SSR primers, ASH primers and probes, RFLPs, AFLPs, isozymes, specific alleles and variable sequences, including SSR, RAPD and the like. Such libraries are then screened against plant genomes to generate a "fingerprint" for each plant under consideration. In some cases a partial fingerprint comprising a sub-portion of the markers is generated in an area of interest. Once the genetic marker alleles of a plant have been identified, the correspondence between one or several of the marker alleles and a desired phenotypic trait is determined through statistical associations based on the methods of this invention.

High throughput screening can be performed in many different formats. Hybridization can take place in a 96-, 324-, or a 1524-well format or in a matrix on a silicon chip or other format.

A number of well-known robotic systems have been developed for high throughput screening, particularly in a 96 well format. These systems include automated work stations like the automated synthesis apparatus developed by Takeda Chemical Industries, LTD. (Osaka, Japan) and many robotic systems utilizing robotic arms (Zymate II, Zymark Corporation, Hopkinton, Mass.; ORCA.TM., Beckman Coulter, Fullerton Calif.). Any of the above devices are suitable for use with the present invention. The nature and implementation of modifications to these devices (if any) so that they can operate as discussed herein will be apparent to persons skilled in the relevant art.

In addition, high throughput screening systems themselves are commercially available (see, e.g., Zymark Corp., Hopkinton, Mass.; Air Technical Industries, Mentor, Ohio; Beckman Instruments, Inc. Fullerton, Calif.; Precision Systems, Inc., Natick, Mass., etc.). These systems typically automate entire procedures including all sample and reagent pipetting, liquid dispensing, timed incubations, and final readings of the microplate or membrane in detector(s) appropriate for the assay. These configurable systems provide high throughput and rapid start up as well as a high degree of flexibility and customization. The manufacturers of such systems provide detailed protocols for the use of their products in high throughput applications.

In one variation of the invention, solid phase arrays are adapted for the rapid and specific detection of multiple polymorphic nucleotides. Typically, a nucleic acid probe is linked to a solid support and a target nucleic acid is hybridized to the probe. Either the probe, or the target, or both, can be labeled, typically with a fluorophore. If the target is labeled, hybridization is evaluated by detecting bound fluorescence. If the probe is labeled, hybridization is typically detected by quenching of the label by the bound nucleic acid. If both the probe and the target are labeled, detection of hybridization is typically performed by monitoring a color shift resulting from proximity of the two bound labels.

In one embodiment, an array of probes are synthesized on a solid support. Using chip masking technologies and photoprotective chemistry, it is possible to generate ordered arrays of nucleic acid probes. These arrays, which are known, e.g., as "DNA chips" or as very large scale immobilized polymer arrays (VLSIPS.TM. arrays) can include millions of defined probe regions on a substrate having an area of about 1 cm.sup.2 to several cm.sup.2.

In another embodiment, capillary electrophoresis is used to analyze polymorphism. This technique works best when the polymorphism is based on size, for example, SSR and AFLP. This technique is described in detail in U.S. Pat. Nos. 5,534,123 and 5,728,282. Briefly, capillary electrophoresis tubes are filled with the separation matrix. The separation matrix contains hydroxyethyl cellulose, urea and optionally formamide. The SSR and AFLP samples are loaded onto the capillary tube and electrophoresed. Because of the small amount of sample and separation matrix required by capillary electrophoresis, the run times are very short. The molecular sizes and therefore, the number of nucleotides present in the nucleic acid sample is determined by techniques described herein. In a high throughput format, many capillary tubes are placed in a capillary electrophoresis apparatus. The samples are loaded onto the tubes and electrophoresis of the samples is run simultaneously. See, Mathies and Huang, (1992) Nature 359:167.

EXAMPLES

It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims.

Example 1

Summary of Breeding Bias Data-Favorable Allelic Forms by Geographic Region

Tables 3 through 9 enumerate favorable allelic forms of chromosome segments contributing to superior agronomic performance in different geographic regions and growing environments. * 95% significance level. ** 99% significance level. UM indicates an unmapped locus. Details regarding SSR and ASH markers and alleles are provided in Appendices I through IV. The geographic regions are defined with respect to the following reference points.

Central Region: Central Midwest United States centered around Des Moines, Iowa.

Canada Region Eastern Canada centered around Chatham, Ontario.

North Region Northern Midwest United States centered around Redwood Falls, Minn.

Illinois Region Northern and central Illinois centered around Champaign, Ill.

East Region: Eastern Midwest United States centered around Napoleon, Ohio.

Mid South Region: Mid Southern United States centered around Hamil, Ill.

South Region Southern United States centered around Memphis, Tenn.

Example 2

Favorable Soybean Alleles and "Target Genotype(s)" for Adaptation to Environments Similar to Those Found in Iowa USA (Central Region)

Three separate breeding bias analyses were conducted to identify favorable alleles that have provided adaptation to geographic regions that are typical of Iowa, USA. The first analysis used 41 elite lines as the "elite population" adapted to Iowa, the second analysis included a larger sample of 71 elite lines (Table 1, Central Region) and the third analysis, performed following the 2003 growing season, used 86 elite lines (Table 1, Central Region 2003). In all cases, the elite population was chosen as a representative sample of elite lines that yield well in Iowa and/or are good parents for developing elite lines adapted to Iowa. Each successive analysis was run after more elite line marker data was available and was therefore considered more rigorous. Despite this fact, the results of the first analysis were very similar and demonstrated that the breeding bias method is useful even with smaller datasets. Herein, results of the second (A) and third (B) analyses are reported due to the larger sample size of the elite population.

A computer program described in U.S. Pat. No. 5,437,697 that simulates the flow of alleles from ancestors to elite lines at each marker locus was used to determine what percent of the elite lines would be expected to inherit each marker allele by chance alone. By doing multiple iterations of the simulation process (10,000 iterations in this case), a statistical measure of random result variation was obtained. The average frequency of each allele in the simulated elite population (from the 10,000 iterations) is herein referred to as the "expected frequency" (EXP) of each marker allele. The expected frequency was then compared to the "observed frequency" (OBS) which is simply a count of how many lines within the elite population actually contain a given allele divided by the total number of elite lines examined. By comparing the observed results to the results of the simulation process, one can determine how often the observed results would be expected to occur by chance alone. If the observed results would only be expected 5% of the time or less due to chance (i.e. a LOD score of 1.3 or greater), it is safe to assume that the observed results did not occur by chance alone. In this case, selection for grain yield must have biased selection towards one or more alleles at the locus in question. The allele(s) that occurred at higher frequency than expected were therefore labeled as "favorable alleles" and those occurring at a lower frequency than expected were labeled as "unfavorable alleles." Favorable alleles are those that must have contributed either directly or indirectly to higher grain yield.

The statistically significant results of the Iowa (A) analysis are shown in Table 10. Since only the major ancestors were genotyped in the analysis, occasionally an allele that was detected in the elite population was not always found in the ancestral population. This resulted in an unusually high LOD score since the frequency of the allele in the ancestral population was assumed to be zero. It is also reasonable to assume that a favorable allele should have increased in frequency by some threshold percentage before that allele should be considered generally "favorable" over the wide range of environments encountered by soybean breeders over the past century. For these reasons, an allele with a LOD score of greater than or equal to 1.3 (95% confidence) AND an observed frequency of at least 25% higher than expected was considered to be "favorable" and "significant" from both a practical and statistical view. Alleles with these criteria plus a LOD score of 2.0 or greater (99% confidence), were considered to be "favorable" and "highly significant." Alleles with a LOD scores of greater than 1.3 but that did not increase in frequency by at least 25% over the past century were considered statistically significant but not enough to be considered generally favorable over most environments.

The term "LOD" score refers to the negative inverse log (base 10) probability that the observed frequency of an allele in the elite population could be attributed to chance alone. More specifically, the LOD score is a measure of the number of rounds that the breeding bias simulation generated an allele frequency at least as extreme as that observed in the actual elite population of soybean lines. The formula for a LOD score of a "favorable" allele is: -1.0.times.log10 (f) where: f=(the number of rounds of simulation where the observed allele frequency in the elite population was greater than that generated by the simulated allele frequency) divided by (the total number of rounds of simulation).

For example, a LOD score of >1.30 is analogous to a probability of <0.05 that the observed allele frequency in the elite population was due to chance alone; a LOD score of >2.00 is analogous to a probability of <0.01 that the observed allele frequency in the elite population was due to chance alone; a LOD score of >3.00 is analogous to a probability of <0.001 that the observed allele frequency in the elite population was due to chance alone; a LOD score of 4.00 is analogous to a probability of 0.0001 that the observed allele frequency in the elite population was due to chance alone. Since only 10,000 rounds of simulation were conducted, the maximum LOD score observed did not go any higher than 4.00.

Based on the Iowa analysis, out of 1540 alleles over 309 genetic marker loci, a total of 94 alleles showed evidence of being favorable by the aforementioned definition: a LOD score of at least 1.30 (95% confidence level) and an increase in allele frequency of at least 25% more than expected by random inheritance. Since some of these favorable alleles are closely linked (i.e., less than 10 CM apart according to independent mapping studies), not all 94 alleles are diagnostic of unique QTL loci. Therefore, the markers were divided into genomic regions with the assumption that markers on the same chromosome that are approximately 10 CM or greater apart are probably diagnostic of different QTL loci.

In addition to listing the favorable alleles that span the genome, Table 10 indicates the favorable allele with the best statistical score and/or the most marker data within each predefined genomic region. The "best" marker allele to use for each region can also be chosen based on which marker works best in the laboratory. In most cases, the marker with the highest LOD score and highest % difference of expected and observed allele frequency was considered to "best" marker in its genomic region. For example, on chromosome C1, there are 4 markers that map to positions 95.8 through 99.0--Satt399, Satt361, P10639A-1, and Satt190. These are all within 10 CM of each other and therefore were assigned to the same genomic region #29. Among these 4 markers, markers Satt399 and Satt190 had the highest possible LOD score of 4.0 when 10,000 iterations of a simulation were done. This means that even after 10,000 iterations were done, there was not even 1 iteration where the simulation produced results more extreme than that observed in the actual elite population. A LOD score of 4.0 is merely the inverse log of the probability (1 in 10,000) that the results obtained at these loci was due to chance alone. From there, one can decide which of these 2 loci would be the best marker to identify the favorable allele in that region. In this case, Satt190 was chosen as the best marker in that region because the results were based on data from 65 as opposed to 61 elite lines. Although a total of 71 elite lines were genotyped for this marker, 6 elite lines had missing data for this locus.

Once a desirable marker is identified and the favorable allele of that marker is determined, selection for that favorable allele in a lab assay can then be used for MAS to identify plants that have the favorable allele. The MAS process can be done at multiple loci simultaneously to select for plants that contain the maximum number of favorable alleles that span the genome. This genome-wide group of favorable alleles upon which selection is based is herein referred to as the "Target Genotype." Table 11 shows the genome-wide Target Genotype for the best locus from each genomic region that meets the criteria of "significant"--i.e. LOD score of at least 1.3 and an increase in allele frequency of at least 25% greater than expected by chance alone. A total of 57 favorable alleles, each representing what was favored by selection in a different genomic region, fit these criteria to make the Target Genotype at LOD1.3 (Table 11, *). If one raises the statistical cutoff to a LOD of 2.0, the Target Genotype focuses in on 30 favorable alleles (Table 11, **). For purposes of MAS, one would want to select for the favorable alleles with the highest statistical significance first. Hence, the logical path for breeding purposes would be to select among segregating progeny for the 30 locus Target Genotype first. Once these loci are fixed for the favorable alleles, the other 27 loci in the 57-locus Target Genotype could be the focus of selection. If resources are unlimited, one could conceivably work with all 57 loci. Loci can also be weighted based on their statistical significance for selection purposes.

Following the 2003 growing season, an additional analysis (13) was performed increasing the number of elite parental lines from 71 to 86, and evaluating an additional 265 SSR markers. The elite lines used in this analysis are given in Table 1.

Significant favorable alleles are given in Table 12. Because more elite lines were used to define the population, and because some previously absent data was obtained for the previously employed markers, some differences in the statistical LOD scores were observed for the markers in Analysis B as compared to prior Analysis A. Almost all of the previously identified markers were confirmed in the expanded analysis, and several new markers in the same genomic regions were found to have higher LOD scores. Accordingly, these new markers are also deemed to be useful in defining the target genotype and identifying and tracking favorable alleles in soybean germplasm.

The Target Genotype is actually a consensus marker genotype that the elite population has been moving towards as the result of selection. Since this genotype is now defined by specific markers and specific favorable alleles, it is possible to practice selection by genotype instead of the inefficient and slow process of selection based on phenotype. The resolution of the consensus genotype is limited only by the genomic coverage provided by the genetic markers that are available for MAS.

Example 3

Status of Favorable Alleles in Soybean Variety A3127

The following example is given to illustrate how the favorable alleles identified in the previous example came together in the most famous transgressive segregant in soybean breeding history. Most new soybean varieties are a small improvement over either of their parents in terms of yield. Yield progress per cycle (5 to 6 years) of breeding is commonly a few percent better than either parent. However, in the early 1980's a variety called A3127 was developed that was much better than either parent (.about.10% better than either parent). In fact, A3127 is probably one of the few lines that all soybean breeders are familiar with because it was famous for being the highest yielding variety of it's time (early 1980's). Prior to commercialization A3127 proved to be much higher yielding than either of its two parents Williams and Essex. A3127 was so popular, that it became the most frequently used parent in soybean breeding history. Since A3127 is adapted to Iowa, we studied the marker profiles of Williams, Essex, and A3127 at the 30 preferred "yield gene" loci identified for the Iowa geographic zone. We found that Williams and Essex differ at 23 out of 30 of these loci (Table 13). Out of the 23 segregating loci, Williams supplied 13 of the favorable alleles and Essex supplied the other 10 favorable alleles. If these really are the major yield loci, one would expect that A3127 would have significantly more favorable alleles than either parent. Amazingly, A3127 had all 23 favorable alleles. Such a segregant would only be expected to happen by chance in 1 out of >8 million progeny (0.5.sup.23) unless these loci really are diagnostic of yield and A3127 is truly a unique segregant. The marker genotype of A3127 is therefore consistent with the hypothesis that these 30 marker loci are diagnostic of yield.

Example 4

Segregation for Yield in Near-Isogenic Sublines

Typically, modern soybean varieties originate from a single plant selected from a partially inbred (commonly F3) population that was generated from a controlled mating between genetically different parents. Seed of the new variety is then multiplied by subsequent pooling (or "bulking") of seed from the self-pollinating progeny of the selected F3 plant. For any locus in the original F3 plant that was heterozygous, the resulting inbred variety will eventually become a mixture of the two homozygotes at said locus. For commercial purposes, soybean varieties are purified for obvious visual traits (e.g., flower color, hilum color, maturity, and other visual traits that are highly heritable and controlled by one or a few genes) but often harbor residual genetic variation that is not obvious to the naked eye. Genetic markers can be used to detect loci contributing to that variation that are still segregating within a so-called "pure line." Since the breeding bias analysis identifies which marker loci have been affected by selection for seed yield, these markers are ideal tools to identify genetic differences among plants within the original heterogeneous variety that may translate into seed yield improvement. These markers can be used to separate the original heterogeneous variety into "near-isogenic" sublines that differ at specific genetic loci.

For example, samples of seed from individual self-pollinated progeny selected from the variety are genotyped, and seed sharing a common allele at one or more identified marker loci is pooled to produce a subline. Such sublines are genetically distinct from one another. In "blind" sublining (i.e., sublining unassisted by marker data) there is no guarantee that the generated sublines are genetically distinct. By pooling seed of many plants with a homogenous marker genotype, enough seed for controlled replicate trials can be obtained in one generation. This is preferable to blind sublining in several ways. First, the only way to attempt genetic homogeneity without markers is to pool the seed of a single plant that may or may not be genetically distinct from the seed of other single plants. Second, a single plant can only supply enough seed for a short row yield test in one environment. Therefore, blind sublining requires subsequent generations of seed increase to obtain enough seed for highly replicated yield trials that are necessary for reliable yield comparisons. Third, even if phenotypic differences are observed with blind sublining, no genomic information is gained for future use. By comparing the field performance of such marker-based sublines in controlled experiments, one can determine the phenotypic effect (e.g., with respect to yield) of each allele (and the corresponding genomic region, if the marker is mapped) in a given genetic background. This is particularly useful for traits, such as yield, in which gene-by-gene and gene-by-environment interactions play a substantial role in phenotype. If one subline performs significantly better than the other, the better subline can be multiplied and released as an improved version of the original variety.

Because selection that is based on genotype (e.g., qualitative DNA polymorphism) and then confirmed with a phenotypic difference is more reliable and heritable than selection based on phenotype alone (i.e., blind sublining), the improvement in phenotype in a blind subline is less likely to be heritable, and unlikely to be repeated in subsequent generations. In contrast, marker-based sublining not only provides useful genomic information, but it also improves the heritability and reproducibility of selected traits. Thus, marker-based "sublining" can be a powerful tool for both product development and to determine the phenotypic effect of individual loci in a given genetic background.

In accordance with this method, the genetic markers identified through breeding bias were shown to be effective tools to select within elite lines for residual yield gain. When genotyping elite lines with genetic markers, 8 random plants from each elite line are routinely sampled and bulked. If the elite line is a 50:50 mixture of two homozygotes at a given locus, a random 8-plant sample will detect both alleles >99% of the time. Using this sampling procedure, segregation within commercial soybean lines is detected at an average of about 4% of the marker loci assayed (e.g., when assaying the "best" marker loci for each chromosomal region).

In the following exemplary trial, six elite lines were examined. Two of the elite lines (91B91 and 92M70) were shown to be segregating at two marker loci each while the other 4 elite lines (92B05, 93B01, 93M80, and 93M90) were segregating at one marker locus as indicated in Table 14.

To develop the sublines, leaf tissue from individual plants of each of the above elite lines was genotyped with the marker(s) segregating in the originating line. Progeny seed from individual homozygous plants of the same marker genotype were then pooled to obtain enough seed of each subline to conduct replicated yield trials. The number of plant used to create each sublime is shown in Table 15.

To determine the relative seed yield, sublines derived from the same elite line were planted in a split plot field design at between 5 and 14 locations, treating each location as an individual replication. Locations were chosen to span the soybean growing region of appropriate maturity zone for the lines being tested in the Midwestern United States. Sublines derived from a given elite line were randomly assigned to split plots within each main plot. Each split plot consisted of two 12-foot long rows of a given subline that were spaced 30 inches apart. Seed yield was measured at maturity and converted to bushels per acre (1 bushel-60 pounds).

Significant yield differences between isolines were detected in 3 of the 6 isoline tests. Since the isolines tested above were derived from pooling many plants of similar genotype, one can reasonably assume that the possibility of residual segregation at other independent loci was randomized and not the source of the yield difference between isolines. The magnitude of the significant yield differences (5.4 to 6.2% between sublines or 2.7 to 3.1% better than the original mixed variety) is of similar magnitude as yield improvements that can typically be obtained using much more exhaustive breeding efforts. New soybean varieties developed without the aid of yield gene markers can easily require hundreds to thousands of yield plots to identify a new variety that is 2 or 3% better than it's best parent. This method can be used to identify yield gains of similar magnitude with very limited resources (2 isolines.times.14 replications=28 plots per test). In addition, by basing selection on a real genetic difference at a locus showing historical breeding bias, the confidence that the yield differences detected are genetically based (as opposed to environmental or experimental error) is substantially increased.

Additionally, these results confirm that the effects of epistasis, gene-by-environment interactions and/or recombination between the marker allele identified by breeding bias and the genetic element underlying yield improvements, while prevalent, do not impair selection of improved soybean varieties, especially if care is taken to identify residual variation and select appropriate sublines. For example, Satt591 was used to select sublines from two different elite lines (93B01 and 93M90). Breeding Bias analysis alone indicated that Satt591 allele 3 was the one favored by breeders over time. In the case of 93B01, allele 3 was the favorable allele since it was the genotype of the better-yielding subline. In contrast, in the case of 93M90, marker allele 1 was the favorable allele.

For example, while the Breeding Bias analysis identifies marker loci linked to genetic elements which have been favorable on most genetic backgrounds in a variety of growing environments, epistatis and other non-additive interactions influence which allele is "favorable" within specific populations, or for particular environments. In addition, disease resistance genes, which contribute to higher relative yield when the disease is prevalent, have been documented to result in lower yield in the absence of disease pressure.

Recombination between a marker locus and the linked genetic element contributing to improved yield can also reduce efficiency of marker assisted. An accepted and proven genetic principle is that the frequency of crossing over between two genetic loci, e.g., a marker locus and a quantitative trait locus, is a function of genetic distance between the two loci. The only way to avoid such phase reversals is to develop "perfect" markers that are diagnostic of the DNA polymorphism that is responsible for the phenotypic difference controlled by the QTL. That is, recombination can only be eliminated by cloning the QTL, and identifying the mutation causally determining the difference in phenotype. Development of perfect markers is possible but is not a trivial exercise. It requires DNA sequencing of the surrounding genomic region and exhaustive sequence-phenotype association to determine conclusively which DNA polymorphism is always associated with the desired phenotype. This is an expensive and time-consuming endeavor, the benefits of which can, in large part, be achieved using the methods and marker loci of the present invention, without the expense and delay of cloning each significant yield QTL associated with a marker locus identified using breeding bias. By periodically confirming marker and phenotype association, using the methods of the present invention, breeders can still reap the benefits of linked (but non-perfect) markers.

Breeding Bias is an effective method for identifying genomic regions that have undergone directional selection. If a marker is close enough (typically within about 10 CM) to an important QTL in a given ancestor, the marker allele originally linked in coupling to the favorable QTL allele will remain in coupling phase for a sufficient period of selection under standard breeding procedures to detect that selection is occurring in the genomic region including the marker. Thus, the marker loci enumerated herein are associated with, and stand as proxies for, QTL contributing to increased yield. Although, with repeated cycles of recombination among members of a given gene pool, genetic crossovers between the marker locus and the QTL will tend to accumulate and eventually result in a state of "linkage equilibrium" between the marker alleles and the QTL, periodic reassessment using the near isogenic subline procedures described herein can insure that selection proceeds for the allele in linkage phase with the desired QTL allele, despite the potential for recombination.

The above subline experiments indicate that marker-based sublining is an effective method for purification and improvement of elite soybean lines. If the number of markers segregating within a given line or population is small, non-additive effects and linkage phase (coupling or repulsion) do not pose a problem, as it is fairly inexpensive to field test all possible recombinants and identify those with the optimal phenotype.

Example 5

Allele Confirmation Using Random Crosses

To increase efficiency of marker assisted selection for improved yield using, e.g., the marker loci enumerated herein, the allele of the marker locus segregating with yield can be confirmed. Following identification of marker loci by Breeding Bias, a limited number of crosses is performed between the highest yielding elite parents for a particular geographic zone or growing environment. Preferably, the parents should be as polymorphic as possible at the identified marker loci. Progeny (F1) from these elite by elite crosses is inbred to generate a large population (e.g., between about 200-5000, typically at least about 1000) F3-derived lines. If desired, inbreeding to later generations can also be done to increase genetic variation among lines.

A subset of "tester lines" is randomly selected from among the inbred lines derived from each cross. For example, between about 10 and 500 lines can be selected. Typically, between about 50 and 100 inbred lines are randomly selected, and enough seed to conduct a reliable yield trial is produced. Several (i.e., between at least 5 and 12, e.g., 8) plants from each inbred line are genotyped at marker loci segregating in the elite parents from which the line was founded, to determine whether the line is segregating or fixed (homozygous) with respect to the relevant marker. The remaining lines ("remnant population") can be stored under conditions that preserve seed viability. If desired, additional lines can be selected for testing, or genotyped for presence of the alleles confirmed to be in coupling linkage phase.

For each cross, a replicated yield trial of each tester line is performed. The test is replicated in enough environments to adequately sample the geographic region of interest and to gain a reliable measure of phenotype. The effect on yield for each marker locus within each cross is determined by comparing the mean yield of lines with a first allele to the mean yield of lines with the alternate allele. If the difference in yield is not significant, the marker can be eliminated in that cross. In contrast, if the difference in yield is significant, the "favorable" allele is confirmed and the locus is used for subsequent marker assisted selection for yield.

Confirmation of the favorable alleles also permits identification of a "target genotype" including all of the favorable alleles across all segregating loci in a particular elite by elite cross. As indicated above, the entire remnant population can be screened with the subset of confirmed markers to identify those segregants that have the highest number of favorable alleles. Typically, at least 5% of the remnant lines that most closely approach the target genotype will be selected, although additional lines can be included at the breeder's discretion. The selected lines can then be evaluated in highly replicated yield tests to identify which crosses perform better than either elite parent under a variety of environments and growing conditions.

While the foregoing invention has been described in some detail for purposes of clarity and understanding, it will be clear to one skilled in the art from a reading of this disclosure that various changes in form and detail can be made without departing from the true scope of the invention. For example, all the techniques and apparatus described above can be used in various combinations.

TABLE-US-00001 TABLE 1 Elite Soybean Lines by Geographic Region Central Iowa RF SJ NP HL ME (Iowa) (2003) Canada (North) (Illinois) (East) (MidSouth) (South) 91B91 92B05 90A07 90B73 92B38 92B52 93B66 94B73 92B05 92B12 90B11 91B12 92B63 91B91 93B67 94B74 92B38 92B38 90B31 91B33 92B74 92B05 93B82 94M70 92B52 92B52 90B43 91B53 93B01 92B38 93B84 94M90 92B63 92B63 90B72 91B91 93B11 92B63 93B85 95B32 92B74 92B74 90B73 91B92 93B15 92B74 93B86 95B33 92B75 92M30 91B01 92B05 93B41 93B01 93B87 95B34 92B84 92M31 91B12 92B12 93B66 93B46 94B01 95B42 93B01 92M70 91B33 92B23 93B67 93B67 94B23 95B43 93B41 92M71 91B52 92B38 93B82 93B82 94B24 95B53 93B45 92M72 91B53 92B63 93B85 93B86 94B53 95B95 93B47 92M80 91B64 92B74 93B86 93B87 94B54 95B96 93B66 92M91 92B95 A1395 93B87 A3431 94B73 95B97 93B67 93B09 93B25 CX105 94B53 CX289 A4009 95M80 93B72 93B36 93B26 D00566D362 94B54 CX394C A4138 96B21 93B82 93B41 A1395 EX04C00 94B73 EX39E00 A4415 96B32 93B85 93B45 CX105 EX06A00 CM428 G3362 A4595 96B51 93B86 93B66 EX10F01 EX10F01 MO15733 MO15733 A4715 96M20 93B87 93B67 P1677 EX13P01 MP39009 P9273 CM428 97B52 94B23 93B68 P9007 EX13Q01 P9306 P9281 CX469C 97B61 94B54 93B82 P9008 EX15N01 P9395 P9306 P9395 A5403 A2835 93B85 P9041 EX16N00 S32Z3 P9392 P9481 A5560 A2943 93B86 P9042 EX16P01 S33N1 P9395 P9482 A5843 A3127 93B87 P9061 EX22Y01 S38T8 S3911 P9492 A5885 A3242 93M10 P9062 BX22Z01 S42H1 ST2660 S3911 A5979 CX232 93M30 P9063 JTM ST2660 ST3380 S4260 A5980 CX253 93M40 P9071 KORADA ST2870 ST3883 S42H1 A6297 HS93-4118 93M50 P9092 MO400644-02 ST3171 XB31C01 S43B5 BEDFORD P9273 93M60 P9132 MO413735- ST3630 XB33B ST3870 CLIFFORD 11-52 P9281 93M80 P9141 MO501577- ST3883 XB34F01 ST3883 CM428 27-23 P9305 93M90 P9163 MO505469- XB31C01 XB35D XB41M01 DAVIS 61-89 P9306 93M92 P9182 P9007 XB34F01 XB35W00 XB42J00 ESSEX P9321 93M93 P9203 P9151 XB38A01 XB38A01 XB42M01 EX53F03 P9341 A2722 P9244 P9233 XB42M01 YB25Y01 XB48H01 EX56H03 P9395 A3237 R01154R002 S03W4 XB48H01 YB25Z01 YB40M01 EX61E03 S22C3 A3322 S0066 S0880 YB28N01 YB27X01 YB40N01 FORREST ST1970 A3431 S0880 S19T9 YB29H01 YB27Y01 YB41Q01 FOWLER ST2250 A4138 S1550 S20F8 YB29J01 YB28N01 YB48L01 HARTWIG ST2488 EX23B03 S1990 S24L2 YB30J01 Y829H01 HOLLADAY ST2688 EX34T03 S19T9 S25J5 YB30N01 YB29J01 HOOD ST2870 EX35F03 ST1073 ST0653 YB35C01 YB30J01 HUTCHESON ST3171 EX36Y01 XB03F01 ST1090 YB36V00 YB30P01 LEE ST3380 EX40T03 XB07E01 ST1970 YB39M01 YB33K01 MANOKIN ST3630 EX44V03 TRAILL YB40M01 YB35C01 P9481 ST3870 S25J5 X9916 YB40N01 YB36V00 P9482 ST3883 S32Z3 XB03F01 YB48L01 YB40N01 P9492 XB22R01 ST1570 XB10D01 P9521 XB25W01 ST1690 XB15M01 P9552 XB31C01 ST1970 XB20M01 P9561 XB34F01 ST2488 XB22R01 P9584 XB35W00 ST2686 XB25W01 P9591 XB38A01 ST2788 YB03E00 P9592 XB42M01 ST2870 YB03G01 P9593 YB22W01 ST3171 YB08D01 P9594 YB25R99 ST3630 YB09F01 P9611 YB25Y01 ST3660 YB09G01 P9631 YB27X01 ST3870 YB10E01 P9641 YB28N01 ST3883 YB11D01 P5960 YB29H01 XB19U04 YB14H01 PHARAOH YB29J01 XB22C04 YB15K99 RA451 YB30J01 XB23W03 YB21F01 S5960 YB30P01 XB23Y02 YB21G01 S6189 YB31E01 XB25E02 YB22S00 S6262 YB32K01 XB25L04 YB22V01 TRACY YB33K01 XB25X04 YB22W01 XB48H01 YB34H01 XB26L04 YB22X01 XB48T04 YB37A01 XB27P04 YB24Z01 XB53J04 YB39M01 XB29A04 YB25R99 XB54K01 YB40M01 XB29D01 YB25X00 XB55J01 YB40N01 XB29K04 YB25Y01 XB55K04 YB41Q01 XB29L04 YB25Z01 XB57M04 XB30E04 YB27Y01 XB58P99 XB31R04 XB58Y02 XB34D04 XB58Z04 XB35L04 XB59U04 YB25R03 XB63D00 YB27L03 XB64C04 YB27S00 XB67A00 YB28A03 YB48L01 YB29T04 YB51D00 YB34R03 YB52J00 YB34S03 YB53C00 YB36E03 YB53D00 YB38E03 YB53E00 YB38G03 YB53G03 YB39V03 YB53H03 YB53K03 YB54H00 YB54J00 YB54L00 YB55G00 YB55H00 YB56E00 YB56G03 YB57L03 YB58B04 YB59T03 YB59V03 YB60N01 YB60P03 YB63E00 YB65C00 YOUNG

TABLE-US-00002 TABLE 2 Exemplary Target Progeny from Segregating Cross. Target Marker Parent 1 Parent 2 Progeny 1 + - + 2 - + + 3 + - + 4 - + + 5 + - + 6 - + + 7 + - + 8 - + + 9 + - + 10 - + + where + = contains the most favorable allele - = contains some other allele

TABLE-US-00003 TABLE 3 Favorable Allelic Forms: Central Region Region Chromosome Position Locus Allele Sig. 2 A1 19.1 SATT042 3 ** 2 A1 19.1 SATT364 3 ** 2 A1 19.1 SATT454 1 ** 2 A1 19.1 SATT526 1 ** 3 A1 27.1 SATT300 3 ** 3 A1 27.1 SATT591 3 ** 3 A1 28.5 SATT155 2 ** 4 A1 69.9 SATT385 1 * 5 A1 87.3 SATT236 1 * 5 A1 87.3 SATT511 1 * 6 A2 0.0 P12390B-1 1 ** 13 A2 184.0 SATT429 4 ** 15 B1 39.0 SATT197 5 * 17 B1 74.1 SATT583 1 * 20 B2 20.0 P12105A-1 1 * 21 B2 45.0 P10641A-1 2 ** 23 B2 86.1 SATT556 2 * 23 B2 88.6 SATT020 2 * 25 B2 110.9 SATT534 7 * 26 B2 120.0 P10638B-2 1 * 29 C1 95.8 SATT399 3 ** 29 C1 96.5 SATT361 2 ** 29 C1 98.0 P10639A-1 1 ** 29 C1 99.0 SATT190 4 ** 31 C1 173.0 SATT338 3 * 36 C2 140.9 SATT557 5 ** 36 C2 145.8 SATT319 1 * 37 C2 165.8 SATT460 5 * 37 C2 170.5 SATT433 3 * 38 C2 193.5 SATT357 1 * 40 D1a 54.7 SATT321 2 * 41 D1a 68.6 SATT383 3 * 41 D1a 69.8 SATT295 2 * 42 D1a 80.3 SATT507 3 * 43 D1a 129.2 SATT129 5 ** 43 D1a 129.2 SATT147 1 * 44 D1b 0.0 SATT216 4 * 45 D1b 20.0 P10621B-2 2 * 46 D1b 39.8 SATT558 3 * 49 D1b 76.1 SATT546 4 * 51 D1b 120.0 P13072A-1 2 * 53 D2 66.9 SATT582 2 ** 54 D2 93.8 SATT389 6 ** 55 D2 110.4 SATT464 1 ** 57 D2 148.3 SATT413 3 * 60 E 40.0 P13074A-1 1 * 62 E 98.0 SATT573 2 * 62 E 98.0 SATT598 1 ** 62 E 100.6 SATT263 2 * 62 E 101.0 SATT602 4 * 62 E 102.2 SATT151 4 * 62 E 102.2 SATT355 3 * 62 E 102.2 SATT452 2 * 64 F 0.0 SATT146 1 ** 64 F 0.0 SATT193 3 ** 64 F 0.0 SATT569 3 ** 64 F 1.7 SATT343 3 ** 64 F 1.9 SATT586 5 ** 66 F 57.5 SATT595 1 * 67 F 85.0 P10782A-1 1 ** 67 F 95.0 SATT334 3 * 70 F 157.8 SATT144 1 * 71 F 165.8 SATT522 5 * 73 G 8.5 SATT356 2 * 75 G 66.1 SATT533 1 * 77 G 100.8 SATT199 1 ** 77 G 103.2 SATT503 3 * 77 G 103.2 SATT517 4 * 79 G 137.0 SATT191 2 * 79 G 138.4 SAT_117 1 * 81 H 0.0 SATT353 2 * 85 H 125.3 SATT181 5 ** 86 I 15.5 SATT127 2 * 87 I 57.9 SATT270 5 * 92 J 61.3 SCT_065 2 ** 92 J 63.6 SATT596 4 ** 92 J 68.0 SATT406 2 ** 92 J 70.8 SATT380 3 ** 92 J 72.6 SATT183 1 ** 92 J 74.4 SATT529 1 ** 94 K 17.9 SATT242 4 ** 96 K 70.9 SATT441 2 * 96 K 72.8 SATT544 2 * 97 K 85.8 SATT240 2 * 101 L 34.6 SATT398 4 ** 102 L 42.3 SATT497 3 * 102 L 47.7 SATT284 2 * 103 L 77.1 SATT166 3 ** 103 L 78.0 SATT448 4 * 104 L 118.0 SATT373 3 ** 104 L 118.6 SATT513 11 * 104 L 124.5 P12394A-1 2 ** 108 M 87.6 SATT536 4 ** 108 M 91.1 SATT175 5 * 109 M 115.0 P10615A-1 1 * 110 M 143.5 SATT346 3 * 111 M 173.5 SATT336 4 * 112 N 20.0 P13069A-1 3 ** 112 N 25.0 P5467A-1 2 ** 115 N 88.6 SATT339 5 * 118 O 2.4 P12396A-1 1 * 118 O 6.3 SATT487 4 ** 119 O 37.7 SATT259 4 ** 120 O 60.5 SATT420 2 ** 120 O 65.1 SATT576 4 * 122 O 103.8 SATT477 3 * 123 O 125.0 SATT581 2 ** 124 O 153.3 SATT153 3 ** 124 O 155.1 SATT243 1 ** 128 UM # P10793A-1 2 * 129 UM # P12391A-1 1 * 129 UM # P12392A-1 1 * 131 UM # P13560A-1 1 * 131 UM # P13561A-1 2 ** 133 UM # SAC1677 3 ** 134 UM # SATT040 4 ** 139 UM # SATT111 3 ** 140 UM # SATT176 3 ** 143 UM # SATT299 5 *

TABLE-US-00004 TABLE 4 Favorable Allelic Forms: Canada Region Chromosome Position Locus Allele Sig. 4 A1 69.9 SATT385 6 * 5 A1 87.3 SATT225 1 * 9 A2 108.7 SATT508 2 ** 11 A2 136.0 P10635A-1 1 * 15 B1 39.0 SATT197 5 * 17 B1 68.1 SATT597 3 * 17 B1 71.6 SCT_026 1 * 17 B1 73.3 SATT415 3 * 17 B1 74.1 SATT583 1 * 18 B1 80.0 P12198A-1 1 * 18 B1 92.1 SATT359 1 * 23 B2 86.1 SATT556 2 * 29 C1 95.8 SATT399 3 ** 29 C1 96.5 SATT361 2 * 29 C1 98.0 P10639A-1 1 ** 29 C1 99.0 SATT190 4 ** 31 C1 173.0 SATT338 3 ** 32 C2 25.4 SATT227 1 * 33 C2 48.1 SATT422 4 * 36 C2 145.8 SATT319 3 * 41 D1a 68.6 SATT267 1 ** 42 D1a 80.3 SATT507 3 ** 42 D1a 85.0 P10620A-1 1 * 43 D1a 129.2 SATT129 2 * 46 D1b 39.8 SATT558 3 * 48 D1b 65.9 SATT506 3 * 53 D2 66.9 SATT582 2 ** 55 D2 110.4 SATT464 1 ** 62 E 100.6 SATT204 4 * 62 E 100.6 SATT263 2 * 62 E 101.0 SATT491 3 ** 62 E 102.2 SATT151 4 * 62 E 102.2 SATT355 3 * 62 B 102.2 SATT452 2 * 64 F 0.0 SATT146 1 ** 64 F 0.0 SATT193 3 * 64 F 0.0 SATT569 3 * 64 F 1.7 SATT343 3 * 64 F 1.7 SATT343 5 * 64 F 1.9 SATT586 5 ** 67 F 85.0 P10782A-1 1 ** 67 F 90.0 P10598A-1 1 * 67 F 95.0 SATT334 3 ** 68 F 114.8 SATT510 3 * 72 F 175.0 P9026A-1 2 * 75 G 53.0 SATT115 1 * 85 H 125.3 SATT181 5 ** 86 I 9.8 SATT367 2 * 86 I 15.5 SATT127 2 ** 86 I 16.6 SCTT012 2 * 87 I 57.9 SATT270 5 * 89 I 114.2 SATT440 2 * 92 J 68.0 SATT406 2 * 92 J 70.8 SATT380 3 * 92 J 72.6 SATT183 1 ** 92 J 74.4 SATT529 1 * 96 K 70.9 SATT441 3 * 97 K 85.8 SATT240 2 * 101 L 32.4 SATT523 1 * 103 L 77.1 SATT166 3 * 103 L 78.0 SATT448 1 * 104 L 124.5 P12394A-1 2 ** 108 M 87.6 SATT536 4 * 110 M 143.5 SATT346 3 * 112 N 20.0 P13069A-1 2 ** 113 N 35.4 SATT584 3 * 113 N 40.0 P3050A-2 2 * 114 N 61.2 SATT387 4 * 118 O 2.4 P12396A-1 1 * 118 O 6.3 SATT487 4 ** 119 O 37.7 SATT259 4 * 119 O 39.0 SATT347 2 * 120 O 69.2 SATT262 5 * 123 O 130.0 P11070A-1 1 ** 131 UM # P13560A-1 1 ** 131 UM # P13561A-1 2 ** 133 UM # SAC1677 3 * 134 UM # SATT040 4 * 138 UM # SATT109 3 ** 139 UM # SATT111 3 ** 140 UM # SATT176 3 * 140 UM # SATT176 5 * 145 UM # SATT512 5 **

TABLE-US-00005 TABLE 5 Favorable Allelic Forms: North Region Region Chromosome Position Locus Allele Sig. 2 A1 19.1 SATT454 1 * 2 A1 19.1 SATT526 1 * 3 A1 27.1 SATT300 3 * 3 A1 27.1 SATT591 3 * 6 A2 0.0 P12390B-1 1 * 9 A2 108.7 SATT327 2 * 9 A2 108.7 SATT508 2 * 12 A2 154.7 SATT409 5 ** 13 A2 184.0 SATT429 4 ** 14 B1 22.5 SATT426 5 * 14 B1 26.7 SATT509 1 ** 15 B1 39.0 SATT197 5 ** 17 B1 73.3 SATT415 3 * 17 B1 74.1 SATT583 1 * 18 B1 80.0 P12198A-1 1 ** 18 B1 85.0 P8584A-1 1 * 18 B1 92.1 SATT359 1 * 21 B2 45.0 P10641A-1 2 * 23 B2 86.1 SATT556 2 * 23 B2 86.1 SATT556 4 * 23 B2 88.6 SATT020 2 * 25 B2 110.9 SATT534 7 * 29 C1 95.8 SATT399 3 ** 29 C1 96.5 SATT361 2 ** 29 C1 98.0 P10639A-1 1 ** 29 C1 99.0 SATT190 4 ** 31 C1 173.0 SATT338 3 ** 32 C2 25.4 SATT227 1 ** 33 C2 53.4 SATT457 1 * 36 C2 140.9 SATT557 5 * 37 C2 168.3 P13073A-1 2 * 37 C2 170.5 SATT433 3 * 41 D1a 68.6 SATT267 1 * 42 D1a 80.3 SATT507 3 ** 42 D1a 82.0 SAT_110 3 * 43 D1a 129.2 SATT129 5 * 46 D1b 39.8 SATT558 3 * 48 D1b 65.9 SATT506 3 ** 51 D1b 120.0 P13072A-1 2 * 53 D2 66.9 SATT582 2 ** 54 D2 93.8 SATT389 6 ** 54 D2 99.6 SATT461 1 * 55 D2 110.4 SATT464 1 ** 62 E 98.0 SATT573 2 * 62 E 98.0 SATT598 1 * 62 E 100.6 SATT204 3 * 64 F 0.0 SATT146 1 ** 64 F 0.0 SATT193 3 ** 64 F 0.0 SATT569 3 ** 64 F 1.7 SATT343 3 ** 64 F 1.9 SATT586 5 ** 65 F 18.0 SATT348 2 * 67 F 85.0 P10782A-1 1 ** 67 F 90.0 P10598A-1 1 * 67 F 95.0 SATT334 3 * 70 F 157.8 SATT144 1 * 71 F 165.8 SATT522 4 * 75 G 53.0 SATT115 3 * 75 G 61.3 SATT594 5 * 76 G 71.6 SATT303 6 * 76 G 72.4 SATT566 1 * 77 G 100.8 SATT199 1 * 77 G 103.2 SATT517 2 * 81 H 0.0 SATT353 2 * 85 H 125.3 SATT181 5 ** 86 I 15.5 SATT127 2 ** 87 I 57.9 SATT270 5 ** 89 I 114.2 SATT440 2 ** 90 J 10.5 SATT249 4 * 92 J 61.3 SCT_065 2 * 92 J 63.6 SATT596 4 * 92 J 68.0 SATT406 2 ** 92 J 70.8 SATT380 3 ** 92 J 72.6 SATT183 1 ** 92 J 74.4 SATT529 1 ** 94 K 17.9 SATT242 4 * 101 L 32.4 SATT523 1 * 101 L 34.6 SATT398 4 ** 102 L 42.3 SATT497 3 ** 103 L 77.1 SATT166 3 ** 103 L 78.0 SATT448 4 * 104 L 118.6 SATT513 11 * 104 L 124.5 P12394A-1 2 ** 108 M 87.6 SATT536 4 ** 108 M 91.1 SATT175 5 * 110 M 143.5 SATT346 3 * 111 M 173.5 SATT336 4 * 112 N 20.0 P13069A-1 3 ** 113 N 38.3 SAT_084 2 * 115 N 88.6 SATT339 5 * 116 N 92.2 SATT255 3 * 118 O 2.4 P12396A-1 1 ** 118 O 6.3 SATT487 4 ** 119 O 37.7 SATT259 4 ** 120 O 60.5 SATT420 2 * 120 O 65.1 SATT576 4 * 123 O 130.0 P11070A-1 1 * 129 UM # P12391A-1 1 * 131 UM # P13560A-1 1 ** 131 UM # P13561A-1 2 ** 133 UM # SAC1677 3 ** 134 UM # SATT040 4 ** 138 UM # SATT109 3 * 139 UM # SATT111 3 ** 140 UM # SATT176 3 **

TABLE-US-00006 TABLE 6 Favorable Allelic Forms: Illinois Region Chromosome Position Locus Allele Sig. 2 A1 19.1 SATT042 3 ** 2 A1 19.1 SATT364 3 ** 2 A1 19.1 SATT454 1 ** 2 A1 19.1 SATT526 1 ** 3 A1 27.1 SATT300 3 ** 3 A1 27.1 SATT591 3 ** 3 A1 28.5 SATT155 2 ** 4 A1 69.9 SATT385 1 * 5 A1 87.3 SATT511 1 * 6 A2 0.0 P12390B-1 1 ** 13 A2 184.0 SATT429 4 ** 15 B1 39.0 SATT197 5 * 16 B1 56.6 SATT519 1 * 21 B2 45.0 P10641A-1 2 ** 23 B2 86.1 SATT556 2 * 23 B2 87.0 SATT272 1 * 23 B2 88.6 SATT020 2 * 24 B2 97.3 SATT066 3 * 26 B2 120.0 P10638B-2 1 * 29 C1 95.8 SATT399 3 ** 29 C1 96.5 SATT361 2 ** 29 C1 98.0 P10639A-1 1 ** 29 C1 99.0 SATT190 4 ** 31 C1 173.0 SATT338 3 * 36 C2 140.9 SATT557 5 ** 36 C2 145.8 SATT319 1 * 37 C2 165.8 SATT460 5 * 37 C2 170.5 SATT433 3 * 38 C2 193.5 SATT357 1 * 40 D1a 54.7 SATT321 2 * 42 D1a 73.1 SATT203 4 * 43 D1a 129.2 SATT129 5 ** 43 D1a 129.2 SATT147 1 * 44 D1b 0.0 SATT216 4 * 45 D1b 20.0 P10621B-2 2 * 46 D1b 39.8 SATT558 3 * 54 D2 93.8 SATT389 6 * 55 D2 110.4 SATT464 1 ** 60 E 40.0 P13074A-1 1 * 62 E 98.0 SATT573 2 * 62 E 98.0 SATT598 1 * 62 E 100.6 SATT263 2 * 62 E 101.0 SATT602 4 * 62 E 102.2 SATT151 4 * 62 E 102.2 SATT355 3 * 62 E 102.2 SATT452 2 * 64 F 0.0 SATT146 1 * 64 F 0.0 SATT193 3 ** 64 F 0.0 SATT569 3 ** 64 F 1.7 SATT343 3 ** 64 F 1.9 SATT586 5 ** 66 F 57.5 SATT595 1 ** 67 F 85.0 P10782A-1 1 * 67 F 95.0 SATT334 3 * 70 F 157.8 SATT144 1 * 71 F 165.8 SAFT522 5 * 73 G 4.0 P7659A-2 2 * 73 G 7.7 SATT570 3 ** 73 G 8.5 SATT356 2 * 75 G 53.0 SATT115 1 ** 75 G 66.1 SATT533 1 * 77 G 100.8 SATT199 1 ** 77 G 103.2 SATT503 3 * 77 G 103.2 SATT517 4 * 79 G 137.0 SATT191 2 ** 79 G 138.4 SAT_117 1 ** 83 H 77.3 SATT279 6 * 85 H 125.3 SATT181 5 ** 86 I 15.5 SATT127 2 * 92 J 61.3 SCT_065 2 ** 92 J 63.6 SATT596 4 * 92 J 68.0 SATT406 2 ** 92 J 70.8 SATT380 3 ** 92 J 72.6 SATT183 1 ** 92 J 74.4 SATT529 1 ** 94 K 17.9 SATT242 4 ** 97 K 85.8 SATT240 2 * 101 L 34.6 SATT398 4 ** 102 L 42.3 SATT497 3 * 103 L 77.1 SATT166 3 ** 103 L 78.0 SATT448 4 * 104 L 118.0 SATT373 3 ** 104 L 124.5 P12394A-1 2 ** 105 M 12.4 SATT590 17 * 106 M 41.0 SATT567 3 * 107 M 78.9 SATT220 3 * 108 M 87.6 SATT536 4 * 108 M 91.1 SATT175 5 * 109 M 115.0 P10615A-1 1 * 112 N 20.0 P13069A-1 3 ** 112 N 25.0 P5467A-1 2 ** 112 N 25.0 P5467A-2 1 * 113 N 38.3 SAT_084 2 * 115 N 88.6 SATT339 5 * 118 O 2.4 P12396A-1 1 * 118 O 6.3 SATT487 4 ** 119 O 37.7 SATT259 4 * 120 O 60.5 SATT420 2 ** 120 O 65.1 SATT576 4 * 122 O 103.8 SATT477 3 * 123 O 125.0 SATT581 2 ** 123 O 130.0 P11070A-1 1 * 124 O 153.3 SATT153 3 ** 124 O 155.1 SATT243 1 * 127 UM # P10632A-1 2 * 128 UM # P10793A-1 2 * 129 UM # P12391A-1 1 * 129 UM # P12392A-1 1 * 131 UM # P13560A-1 1 * 131 UM # P13561A-1 2 ** 133 UM # SAC1677 3 ** 134 UM # SATT040 4 ** 139 UM # SATT111 3 ** 140 UM # SATT176 3 ** 141 UM # SATT219 1 * 143 UM # SATT299 5 *

TABLE-US-00007 TABLE 7 Favorable Allelic Forms: East Region Region Chromosome Position Locus Allele Sig. 2 A1 19.1 SATT042 3 ** 2 A1 19.1 SATT364 3 ** 2 A1 19.1 SATT454 1 ** 2 A1 19.1 SATT526 1 ** 3 A1 27.1 SATT300 3 ** 3 A1 27.1 SATT591 3 ** 3 A1 28.5 SATT155 2 ** 4 A1 69.9 SATT385 1 * 5 A1 87.3 SATT236 1 * 5 A1 87.3 SATT511 1 * 6 A2 0.0 P12390B-1 1 ** 12 A2 154.7 SATT409 5 * 13 A2 184.0 SATT429 4 ** 15 B1 39.0 SATT197 5 * 17 B1 74.1 SATT583 1 * 21 B2 45.0 P10641A-1 2 ** 23 B2 86.1 SATT556 2 * 23 B2 88.6 SATT020 2 * 26 B2 120.0 P10638B-2 1 * 29 C1 95.8 SATT399 3 ** 29 C1 96.5 SATT361 2 ** 29 C1 98.0 P10639A-1 1 ** 29 C1 99.0 SATT190 4 ** 31 C1 173.0 SATT338 3 * 36 C2 140.9 SATT557 5 ** 36 C2 145.8 SATT319 1 * 37 C2 170.5 SATT433 3 * 38 C2 193.5 SATT357 1 * 40 D1a 54.7 SATT321 2 * 41 D1a 68.6 SATT383 3 * 43 D1a 129.2 SATT129 5 ** 43 D1a 129.2 SATT147 1 * 45 D1b 20.0 P10621B-2 2 * 46 D1b 39.8 SATT558 3 * 53 D2 66.9 SATT582 2 * 54 D2 93.8 SATT389 6 * 55 D2 110.4 SATT464 1 ** 60 E 40.0 P13074A-1 1 * 62 E 98.0 SATT573 2 * 62 E 98.0 SATT598 1 * 62 E 100.6 SATT263 2 * 62 E 101.0 SATT602 4 * 62 E 102.2 SATT151 4 * 62 E 102.2 SATT355 1 * 62 E 102.2 SATT452 2 * 64 F 0.0 SATT146 1 ** 64 F 0.0 SATT193 3 ** 64 F 0.0 SATT569 3 ** 64 F 1.7 SATT343 3 ** 64 F 1.9 SATT586 5 ** 66 F 57.5 SATT595 1 * 67 F 85.0 P10782A-1 1 ** 67 F 95.0 SATT334 3 * 70 F 157.8 SATT144 1 * 73 G 8.5 SATT356 2 * 75 G 53.0 SATT115 1 ** 75 G 66.1 SATT533 1 * 77 G 100.8 SATT199 1 ** 77 G 103.2 SATT503 3 * 77 G 103.2 SATT517 4 ** 79 G 137.0 SATT191 2 * 79 G 138.4 SAT_117 1 * 83 H 77.3 SATT279 6 * 85 H 125.3 SATT181 5 ** 86 I 15.5 SATT127 2 * 92 J 61.3 SCT_065 2 ** 92 J 63.6 SATT596 4 ** 92 J 68.0 SATT406 2 ** 92 J 70.8 SATT380 3 ** 92 J 72.6 SATT183 1 ** 92 J 74.4 SATT529 1 ** 94 K 17.9 SATT242 4 ** 97 K 85.8 SATT240 2 * 103 L 77.1 SATT166 3 ** 104 L 118.0 SATT373 3 ** 104 L 124.5 P12394A-1 2 ** 108 M 87.6 SATT536 4 ** 108 M 91.1 SATT175 5 * 109 M 115.0 P10615A-1 1 * 110 M 143.5 SATT346 3 * 111 M 173.5 SATT336 4 * 112 N 20.0 P13069A-1 3 ** 112 N 25.0 P5467A-1 2 ** 112 N 25.0 P5467A-2 1 * 113 N 38.3 SAT_084 2 * 115 N 88.6 SATT339 5 * 118 O 2.4 P12396A-1 1 * 118 O 6.3 SATT487 4 ** 119 O 37.7 SATT259 4 ** 120 O 60.5 SATT420 2 ** 120 O 65.1 SATT576 4 * 120 O 69.2 SATT473 2 * 122 O 103.8 SATT477 3 * 123 O 125.0 SATT581 2 ** 123 O 130.0 P11070A-1 1 * 124 O 153.3 SATT153 3 ** 124 O 155.1 SATT243 1 ** 128 UM # P10793A-1 2 * 129 UM # P12391A-1 1 * 129 UM # P12392A-1 1 * 131 UM # P13560A-1 1 * 131 UM # P13561A-1 2 ** 133 UM # SAC1677 3 ** 134 UM # SATT040 4 ** 139 UM # SATT111 3 ** 140 UM # SATT176 3 ** 141 UM # SATT219 9 ** 143 UM # SATT299 5 *

TABLE-US-00008 TABLE 8 Favorable Allelic Forms: Mid South Region Region Chromosome Position Locus Allele Sig. 2 A1 19.1 SATT042 3 * 2 A1 19.1 SATT364 3 ** 2 A1 19.1 SATT454 1 ** 2 A1 19.1 SATT526 1 ** 3 A1 27.1 SATT300 3 ** 3 A1 27.1 SATT591 3 ** 3 A1 28.5 SATT155 2 ** 5 A1 87.3 SATT511 1 * 6 A2 0.0 P12390B-1 1 * 8 A2 96.2 SATT233 6 * 11 A2 136.0 P10635A-1 1 * 12 A2 154.7 SATT409 2 * 12 A2 161.8 SATT228 4 ** 13 A2 184.0 SATT429 4 ** 15 B1 39.0 SATT197 5 * 18 B1 92.1 SATT359 3 ** 20 B2 20.0 P12105A-1 1 * 21 B2 45.0 P10641A-1 2 ** 23 B2 86.1 SATT556 2 * 23 B2 87.0 SATT272 1 * 23 B2 88.6 SATT020 2 * 29 C1 95.8 SATT399 3 ** 29 C1 96.5 SATT361 2 * 29 C1 98.0 P10639A-1 1 * 29 C1 99.0 SATT190 4 ** 31 C1 173.0 SATT338 3 * 36 C2 140.9 SATT557 5 ** 36 C2 145.8 SATT319 1 * 37 C2 165.8 SATT460 5 * 40 D1a 54.7 SATT321 2 ** 42 D1a 73.1 SATT203 4 * 43 D1a 129.2 SATT129 5 ** 44 D1b 0.0 SATT216 4 * 45 D1b 20.0 P10621B-2 2 ** 46 D1b 39.8 SATT558 3 * 54 D2 93.8 SATT389 6 * 55 D2 110.4 SATT464 1 ** 62 E 98.0 SATT598 1 * 62 E 100.6 SATT263 2 * 62 E 102.2 SATT151 4 * 62 E 102.2 SATT355 3 * 62 E 102.2 SATT452 2 * 64 F 0.0 SATT146 1 ** 64 F 0.0 SATT193 3 ** 64 F 0.0 SATT569 3 ** 64 F 1.7 SATT343 3 ** 64 F 1.9 SATT586 5 ** 65 F 16.4 SATT423 3 * 65 F 18.0 SATT348 4 * 66 F 57.5 SATT595 1 * 67 F 85.0 P10782A-1 1 ** 67 F 95.0 SATT334 3 * 73 G 2.0 P10646A-1 2 ** 73 G 3.0 P5219A-1 2 * 73 G 4.0 P7659A-2 2 * 73 G 7.7 SATT570 3 ** 73 G 8.5 SATT356 2 * 75 G 53.0 SATT115 1 * 75 G 66.1 SATT533 1 * 77 G 100.8 SATT199 1 * 77 G 103.2 SATT503 3 * 77 G 103.2 SATT517 4 * 79 G 137.0 SATT191 2 * 79 G 138.4 SAT_117 1 ** 84 H 116.9 SATT142 3 * 85 H 125.3 SATT181 5 ** 86 I 9.8 SATT367 6 * 86 I 15.5 SATT127 2 * 89 I 114.2 SATT440 3 * 92 J 61.3 SCT_065 2 ** 92 J 63.6 SATT596 4 * 92 J 68.0 SATT406 2 ** 92 J 70.8 SATT380 3 ** 92 J 72.6 SATT183 1 ** 92 J 74.4 SATT529 1 ** 94 K 17.9 SATT242 4 * 96 K 72.8 SATT544 2 * 97 K 85.8 SATT240 2 * 101 L 34.6 SATT398 4 ** 102 L 42.3 SATT497 3 * 103 L 77.1 SATT166 3 ** 103 L 78.0 SATT448 4 * 104 L 124.5 P12394A-1 2 * 107 M 78.9 SATT220 3 * 108 M 87.6 SATT536 4 * 109 M 115.0 P10615A-1 1 * 110 M 143.5 SATT346 3 * 115 N 88.6 SATT339 5 * 118 O 2.4 P12396A-1 1 * 118 O 6.3 SATT487 4 ** 119 O 37.7 SATT259 4 * 120 O 60.5 SATT420 2 * 120 O 65.1 SATT576 4 * 122 O 103.8 SATT477 3 * 123 O 125.0 SATT581 2 ** 124 O 153.3 SATT153 3 ** 124 O 155.1 SATT243 1 * 129 UM # P12392A-1 1 * 131 UM # P13560A-1 1 * 131 UM # P13561A-1 2 ** 133 UM # SAC1677 3 * 134 UM # SATT040 4 ** 139 UM # SATT111 3 ** 140 UM # SATT176 3 ** 141 UM # SATT219 9 ** 143 UM # SATT299 5 *

TABLE-US-00009 TABLE 9 Favorable Allelic Forms: South Region Region Chromosome Position Locus Allele Sig. 2 A1 14.6 SATT165 2 * 2 A1 19.1 SATT042 3 * 2 A1 19.1 SATT042 4 * 2 A1 19.1 SATT364 4 * 2 A1 19.1 SATT526 1 ** 3 A1 27.1 SATT300 3 ** 3 A1 27.1 SATT591 3 * 3 A1 28.5 SATT155 2 ** 4 A1 69.9 SATT385 1 * 5 A1 87.3 SATT236 1 * 5 A1 87.3 SATT511 1 * 6 A2 0.0 P12390B-1 1 * 7 A2 20.0 SATT480 1 * 9 A2 108.7 SATT329 2 * 14 B1 26.7 SATT509 6 * 17 B1 71.6 SCT_026 2 ** 17 B1 74.1 SATT583 3 * 17 B1 74.8 SATT430 1 * 18 B1 92.1 SATT359 3 ** 19 B1 120.0 P10648A-1 2 * 21 B2 55.8 SATT168 2 * 23 B2 86.1 SATT556 2 * 23 B2 87.0 SATT272 2 * 29 C1 95.8 SATT399 3 * 29 C1 99.0 SATT190 4 * 33 C2 53.4 SATT457 2 * 37 C2 168.3 SATT307 2 * 37 C2 168.3 SCT_028 2 * 37 C2 170.5 SATT433 4 * 38 C2 193.5 SATT357 1 * 40 D1a 54.7 SATT321 2 * 46 D1b 39.8 SATT558 3 * 47 D1b 51.6 SATT266 1 * 48 D1b 64.3 SATT282 4 * 48 D1b 65.1 SATT537 8 * 54 D2 93.8 SATT389 6 * 54 D2 99.6 SATT461 1 * 55 D2 106.6 SATT311 2 * 55 D2 107.8 SATT514 1 * 55 D2 110.4 SATT464 1 ** 55 D2 112.1 SATT543 4 ** 56 D2 139.1 SATT186 1 * 60 E 40.0 P13074A-1 1 * 61 E 80.0 P10624A-1 2 * 62 E 100.6 SATT204 1 * 62 E 101.0 SATT491 3 * 62 E 102.2 SATT151 3 * 62 E 102.2 SATT355 3 * 62 E 102.2 SATT452 2 ** 64 F 0.0 SATT146 4 ** 64 F 0.0 SATT569 3 * 64 F 1.7 SATT343 5 * 64 F 1.9 SATT586 2 * 67 F 87.5 P3436A-1 2 ** 67 F 95.0 SATT334 3 * 68 F 114.8 SATT510 5 ** 70 F 157.8 SATT144 1 * 73 G 2.0 P10646A-1 2 ** 73 G 3.0 P5219A-1 2 * 73 G 4.0 P7659A-2 2 * 73 G 7.7 SATT570 3 ** 73 G 8.5 SATT356 2 * 74 G 13.5 SATT130 2 * 75 G 61.3 SATT594 6 ** 75 G 66.1 SATT533 1 * 76 G 71.6 SATT303 7 * 76 G 71.6 SATT303 9 ** 76 G 72.4 SATT352 10 ** 76 G 72.4 SATT566 3 * 77 G 100.8 SATT199 1 ** 77 G 103.2 SATT503 3 ** 77 G 103.2 SATT517 4 * 79 G 137.0 SATT191 2 * 79 G 138.4 SAT_117 1 ** 81 H 0.0 SATT353 2 * 82 H 42.3 SATT442 4 ** 83 H 77.3 SATT279 5 ** 83 H 77.3 SATT314 1 ** 86 I 9.8 SATT367 6 ** 86 I 15.5 SATT127 2 * 87 I 57.9 SATT270 5 * 89 I 115.0 P10640A-1 1 * 92 J 67.2 SATT280 5 ** 92 J 70.8 SATT380 3 ** 92 J 72.6 SATT183 2 ** 93 J 118.0 SATT431 3 ** 94 K 17.9 SATT242 1 ** 95 K 44.0 SATT102 2 * 98 K 144.0 P10618A-1 1 * 98 K 144.3 SATT475 1 * 99 K 164.8 SATT196 4 * 101 L 32.4 SATT523 3 * 101 L 33.9 SATT418 4 * 103 L 77.1 SATT166 1 ** 103 L 78.0 SATT448 4 * 104 L 118.0 SATT373 17 * 104 L 118.6 SATT513 1 ** 104 L 124.5 P12394A-1 2 * 105 M 12.4 SATT590 2 * 108 M 87.6 SATT536 4 * 110 M 139.4 SATT250 1 * 113 N 35.4 SATT584 2 * 114 N 61.2 SATT387 5 ** 115 N 80.2 SATT549 5 * 117 N 113.0 SATT257 2 * 118 O 2.4 P12396A-1 1 * 118 O 6.3 SATT487 1 ** 119 O 37.7 SATT259 3 ** 119 O 39.0 SATT347 2 * 120 O 65.1 SATT576 4 * 120 O 67.5 SATT550 1 * 124 O 155.1 SATT243 2 * 125 O 175.7 P8230A-1 2 ** 126 UM # P10623A-1 2 * 129 UM # P12391A-1 2 * 131 UM # P13561A-1 1 * 132 UM # p2481A-1 1 * 133 UM # SAC1677 3 ** 136 UM # SATT108 1 * 139 UM # SATT111 3 * 140 UM # SATT176 8 ** 141 UM # SATT219 4 ** 143 UM # SATT299 5 * 145 UM # SATT512 3 *

TABLE-US-00010 TABLE 10 Favorable Alleles: Iowa (A) Best Marker in Genomic Genomic LOD CHG Region Chromosome Position Locus Allele Region Sig. Iowa EXP Iowa OBS Iowa Iowa #ELI Iowa 2 A1 19.1 Satt042 3 ** 2.68 0.13 0.75 0.62 67 2 A1 19.1 Satt364 3 ** 3.22 0.05 0.72 0.67 68 2 A1 19.1 Satt454 1 ** 3.70 0.05 0.74 0.69 69 2 A1 19.1 Satt526 1 Best ** 4.00 0.06 0.79 0.72 68 3 A1 27.1 Satt300 3 ** 3.22 0.08 0.77 0.69 64 3 A1 27.1 Satt591 3 Best ** 3.22 0.13 0.82 0.70 67 3 A1 28.5 Satt155 2 ** 2.96 0.18 0.82 0.64 66 5 A1 87.3 Satt511 1 Best * 1.40 0.14 0.57 0.44 61 6 A2 0.0 P12390B-1 1 Best ** 2.59 0.32 0.89 0.57 66 13 A2 184.0 Satt429 4 Best ** 4.00 0.02 0.63 0.61 53 15 B1 39.0 Satt197 5 Best * 1.66 0.22 0.64 0.41 48 21 B2 45.0 P10641A-1 2 Best ** 3.22 0.34 0.94 0.60 70 25 B2 110.9 Satt534 7 Best * 1.47 0.49 0.89 0.40 61 26 B2 120.0 P10638B-2 1 Best * 1.91 0.62 0.94 0.33 70 29 C1 95.8 Satt399 3 ** 4.00 0.08 0.89 0.81 61 29 C1 96.5 Satt361 2 ** 3.05 0.15 0.80 0.65 68 29 C1 98.0 P10639A-1 1 ** 3.22 0.19 0.86 0.66 63 29 C1 99.0 Satt190 4 Best ** 4.00 0.05 0.79 0.73 65 31 C1 173.0 Satt338 3 Best * 1.55 0.25 0.71 0.46 63 36 C2 140.9 Satt557 5 Best ** 3.52 0.58 1.00 0.42 70 36 C2 145.8 Satt319 1 * 1.90 0.74 1.00 0.26 67 37 C2 165.8 Satt460 5 * 1.43 0.63 0.97 0.34 44 37 C2 170.5 Satt433 3 Best * 1.59 0.15 0.48 0.34 61 38 C2 193.5 Satt357 1 Best * 1.52 0.68 0.97 0.29 66 40 D1a 54.7 Satt321 2 Best * 1.82 0.19 0.69 0.50 66 41 D1a 69.8 Satt295 2 Best * 1.67 0.70 0.98 0.28 50 42 D1a 80.3 Satt507 3 Best * 1.37 0.20 0.63 0.43 66 43 D1a 129.2 Satt129 5 Best ** 2.89 0.31 0.93 0.61 61 43 D1a 129.2 Satt147 1 * 1.46 0.69 0.97 0.28 62 46 D1b 39.8 Satt558 3 Best * 1.76 0.29 0.81 0.52 56 53 D2 66.9 Satt582 2 ** 2.89 0.01 0.28 0.27 50 54 D2 93.8 Satt389 6 Best ** 2.46 0.05 0.53 0.49 63 55 D2 110.4 Satt464 1 Best ** 3.40 0.05 0.67 0.62 66 62 E 98.0 Satt573 2 * 1.72 0.46 0.91 0.45 62 62 E 98.0 Satt598 1 Best ** 2.28 0.38 0.92 0.54 66 62 E 100.6 Satt263 2 * 1.88 0.07 0.53 0.46 59 62 E 101.0 Satt602 4 * 1.36 0.12 0.43 0.31 61 62 E 102.2 Satt151 4 * 1.78 0.05 0.44 0.40 60 64 F 0.0 Satt146 1 ** 2.89 0.20 0.86 0.66 50 64 F 0.0 Satt193 3 ** 3.70 0.10 0.84 0.74 62 64 F 0.0 Satt569 3 ** 3.16 0.15 0.86 0.71 69 64 F 1.7 Satt176 3 ** 4.00 0.09 0.85 0.76 71 64 F 1.7 Satt343 3 Best ** 4.00 0.09 0.89 0.80 66 64 F 1.9 Satt586 5 ** 4.00 0.09 0.84 0.75 55 64 F 2.5 Satt040 4 ** 3.52 0.09 0.81 0.73 67 67 F 85.0 P10782A-1 1 Best ** 3.16 0.27 0.90 0.64 70 70 F 157.8 Satt144 1 Best * 1.79 0.45 0.90 0.45 67 71 F 165.8 Satt522 5 Best * 1.48 0.04 0.32 0.27 63 73 G 8.5 Satt356 2 Best * 1.42 0.69 0.97 0.28 68 75 G 66.1 Satt533 1 Best * 1.94 0.43 0.90 0.46 68 77 G 100.8 Satt199 1 Best ** 3.22 0.44 0.98 0.54 65 77 G 103.2 Satt517 4 * 1.54 0.10 0.54 0.44 64 79 G 137.0 Satt191 2 * 1.65 0.15 0.62 0.47 65 79 G 138.4 Sat_117 1 Best * 1.70 0.20 0.68 0.48 66 85 H 125.3 Satt181 5 Best ** 2.14 0.05 0.61 0.56 61 86 I 15.5 Satt127 2 Best * 1.99 0.62 0.99 0.37 58 92 J 61.3 Sct_065 2 ** 3.70 0.26 0.91 0.65 58 92 J 63.6 Satt596 4 ** 2.47 0.14 0.79 0.65 65 92 J 68.0 Satt406 2 Best ** 3.52 0.18 0.87 0.69 66 92 J 70.8 Satt380 3 ** 3.70 0.28 0.94 0.66 63 92 J 72.6 Satt183 1 ** 3.30 0.45 0.97 0.53 69 92 J 74.4 Satt529 1 ** 3.52 0.38 0.97 0.59 61 94 K 17.9 Satt242 4 Best ** 3.05 0.07 0.71 0.64 65 97 K 85.8 Satt240 2 Best * 1.49 0.11 0.52 0.41 54 101 L 34.6 Satt398 4 Best ** 2.00 0.33 0.83 0.50 51 103 L 77.1 Satt166 3 Best ** 4.00 0.10 0.90 0.80 61 103 L 78.0 Satt448 4 * 1.46 0.22 0.68 0.46 67 104 L 118.0 Satt373 3 ** 3.70 0.00 0.37 0.36 52 104 L 118.6 Satt513 11 * 1.47 0.07 0.33 0.26 40 104 L 124.5 P12394A-1 2 Best ** 3.05 0.66 1.00 0.35 71 108 M 87.6 Satt536 4 Best ** 3.70 0.14 0.83 0.70 66 108 M 91.1 Satt175 5 * 1.99 0.19 0.77 0.58 68 109 M 115.0 P10615A-1 1 Best * 1.75 0.10 0.54 0.44 70 110 M 143.5 Satt346 3 Best * 1.30 0.16 0.61 0.45 61 111 M 173.5 Satt336 4 Best * 1.63 0.25 0.71 0.46 44 112 N 20.0 P13069A-1 3 Best ** 4.00 0.00 0.31 0.31 61 112 N 25.0 P5467A-1 2 ** 4.00 0.00 0.26 0.26 62 115 N 88.6 Satt339 5 Best * 1.96 0.19 0.73 0.54 60 118 O 2.4 P12396A-1 1 * 1.89 0.64 0.97 0.33 66 118 O 6.3 Satt487 4 Best ** 4.00 0.37 0.97 0.60 64 119 O 37.7 Satt259 4 Best ** 3.30 0.37 0.92 0.55 63 120 O 60.5 Satt420 2 Best ** 2.28 0.30 0.85 0.54 68 120 O 65.1 Satt576 4 * 1.80 0.22 0.77 0.55 44 122 O 103.8 Satt477 3 Best * 1.32 0.43 0.83 0.40 53 123 O 125.0 Satt581 2 Best ** 2.70 0.35 0.88 0.53 69 124 O 153.3 Satt153 3 Best ** 2.96 0.49 0.94 0.46 68 124 O 155.1 Satt243 1 ** 2.17 0.60 0.96 0.36 56 129 UM P12391A-1 1 Best * 1.84 0.39 0.84 0.45 69 129 UM P12392A-1 1 Best * 1.30 0.55 0.88 0.33 69 131 UM P13560A-1 1 Best * 1.71 0.23 0.64 0.41 70 131 UM P13561A-1 2 Best ** 3.10 0.63 1.00 0.37 67 133 UM Sac1677 3 Best ** 4.00 0.15 0.90 0.75 70 139 UM Satt111 3 Best ** 4.00 0.08 0.81 0.74 67 143 UM Satt299 5 Best * 1.59 0.17 0.65 0.48 61 * 95% significance level ** 99% significance level

TABLE-US-00011 TABLE 11 Significant Alleles at the "Best" marker locus in each genomic region. SIGNIF LOD EXP OBS CHG #ELI Region Chromosome Position Locus Allele Iowa Iowa Iowa Iowa Iowa Iowa 2 A1 19.1 Satt526 1 ** 4.00 0.06 0.79 0.72 68 3 A1 27.1 Satt591 3 ** 3.22 0.13 0.82 0.70 67 5 A1 87.3 Satt511 1 * 1.40 0.14 0.57 0.44 61 6 A2 0.0 P12390B-1 1 ** 2.59 0.32 0.89 0.57 66 13 A2 184.0 Satt429 4 ** 4.00 0.02 0.63 0.61 53 15 B1 39.0 Satt197 5 * 1.66 0.22 0.64 0.41 48 21 B2 45.0 P10641A-1 2 ** 3.22 0.34 0.94 0.60 70 25 B2 110.9 Satt534 7 * 1.47 0.49 0.89 0.40 61 26 B2 120.0 P10638B-2 1 * 1.91 0.62 0.94 0.33 70 29 C1 99.0 Satt190 4 ** 4.00 0.05 0.79 0.73 65 31 C1 173.0 Satt338 3 * 1.55 0.25 0.71 0.46 63 36 C2 140.9 Satt557 5 ** 3.52 0.58 1.00 0.42 70 37 C2 170.5 Satt433 3 * 1.59 0.15 0.48 0.34 61 38 C2 193.5 Satt357 1 * 1.52 0.68 0.97 0.29 66 40 D1a 54.7 Satt321 2 * 1.82 0.19 0.69 0.50 66 41 D1a 69.8 Satt295 2 * 1.67 0.70 0.98 0.28 50 42 D1a 80.3 Satt507 3 * 1.37 0.20 0.63 0.43 66 43 D1a 129.2 Satt129 5 ** 2.89 0.31 0.93 0.61 61 46 D1b 39.8 Satt558 3 * 1.76 0.29 0.81 0.52 56 54 D2 93.8 Satt389 6 ** 2.46 0.05 0.53 0.49 63 55 D2 110.4 Satt464 1 ** 3.40 0.05 0.67 0.62 66 62 E 98.0 Satt598 1 ** 2.28 0.38 0.92 0.54 66 64 F 1.7 Satt343 3 ** 4.00 0.09 0.89 0.80 66 67 F 85.0 P10782A-1 1 ** 3.16 0.27 0.90 0.64 70 70 F 157.8 Satt144 1 * 1.79 0.45 0.90 0.45 67 71 F 165.8 Satt522 5 * 1.48 0.04 0.32 0.27 63 73 G 8.5 Satt356 2 * 1.42 0.69 0.97 0.28 68 75 G 66.1 Satt533 1 * 1.94 0.43 0.90 0.46 68 77 G 100.8 Satt199 1 ** 3.22 0.44 0.98 0.54 65 79 G 138.4 Sat_117 1 * 1.70 0.20 0.68 0.48 66 85 H 125.3 Satt181 5 ** 2.14 0.05 0.61 0.56 61 86 I 15.5 Satt127 2 * 1.99 0.62 0.99 0.37 58 92 J 68.0 Satt406 2 ** 3.52 0.18 0.87 0.69 66 94 K 17.9 Satt242 4 ** 3.05 0.07 0.71 0.64 65 97 K 85.8 Satt240 2 * 1.49 0.11 0.52 0.41 54 101 L 34.6 Satt398 4 ** 2.00 0.33 0.83 0.50 51 103 L 77.1 Satt166 3 ** 4.00 0.10 0.90 0.80 61 104 L 124.5 P12394A-1 2 ** 3.05 0.66 1.00 0.35 71 108 M 87.6 Satt536 4 ** 3.70 0.14 0.83 0.70 66 109 M 115.0 P10615A-1 1 * 1.75 0.10 0.54 0.44 70 110 M 143.5 Satt346 3 * 1.30 0.16 0.61 0.45 61 111 M 173.5 Satt336 4 * 1.63 0.25 0.71 0.46 44 112 N 20.0 P13069A-1 3 ** 4.00 0.00 0.31 0.31 61 115 N 88.6 Satt339 5 * 1.96 0.19 0.73 0.54 60 118 O 6.3 Satt487 4 ** 4.00 0.37 0.97 0.60 64 119 O 37.7 Satt259 4 ** 3.30 0.37 0.92 0.55 63 120 O 60.5 Satt420 2 ** 2.28 0.30 0.85 0.54 68 122 O 103.8 Satt477 3 * 1.32 0.43 0.83 0.40 53 123 O 125.0 Satt581 2 ** 2.70 0.35 0.88 0.53 69 124 O 153.3 Satt153 3 ** 2.96 0.49 0.94 0.46 68 129 UM P12391A-1 1 * 1.84 0.39 0.84 0.45 69 129 UM P12392A-1 1 * 1.30 0.55 0.88 0.33 69 131 UM P13560A-1 1 * 1.71 0.23 0.64 0.41 70 131 UM P13561A-1 2 ** 3.10 0.63 1.00 0.37 67 133 UM Satt677 3 ** 4.00 0.15 0.90 0.75 70 139 UM Satt111 3 ** 4.00 0.08 0.81 0.74 67 143 UM Satt299 5 * 1.59 0.17 0.65 0.48 61 * 95% significance level ** 99% significance level

TABLE-US-00012 TABLE 12 Favorable Alleles: Iowa (B) New Best Marker Marker in in Genomic Genomic Genomic LOD EXP CHG Region Chromosome Position Locus Allele Region Region Sig. Iowa Iowa OBS Iowa Iowa #ELI Iowa 1 A1 1.4 Satt684 3 NEW Best * 1.84 0.03 0.36 0.36 79 2 A1 19.1 Satt042 3 ** 2.66 0.14 0.77 0.64 82 2 A1 19.1 Satt364 3 ** 3.16 0.05 0.70 0.65 65 2 A1 19.1 Satt454 1 ** 3.40 0.06 0.71 0.64 66 2 A1 19.1 Satt526 1 Best ** 4.00 0.07 0.77 0.70 86 3 A1 27.1 Satt300 3 ** 3.30 0.11 0.79 0.68 82 3 A1 27.1 Satt591 3 Best ** 3.40 0.15 0.83 0.69 81 3 A1 28.5 Satt155 2 ** 2.89 0.18 0.83 0.65 81 4 A1 69.9 Satt385 1 Best * 1.99 0.44 0.91 0.48 80 7.5 A2 41.8 Satt632-TB 4 NEW Best * 1.88 0.66 1.00 0.34 41 13 A2 184.0 Satt429 4 Best ** 4.00 0.04 0.80 0.76 76 14 B1 27.6 SAT_261 1 NEW Best ** 2.42 0.49 1.00 0.51 28 21 B2 45.0 P10641A-1 2 Best ** 3.70 0.34 0.99 0.65 86 23 B2 86.1 Satt556 2 Best * 1.73 0.16 0.75 0.59 76 26 B2 120.0 P10638B-2 1 Best * 1.30 0.63 0.93 0.30 85 29 C1 95.8 Satt399 3 ** 4.00 0.07 0.89 0.82 77 29 C1 96.5 Satt361 2 ** 3.30 0.16 0.83 0.67 64 29 C1 99.0 SATT661-TB 2 NEW * 1.68 0.39 0.94 0.55 59 29 C1 99.0 Satt190 4 Best ** 4.00 0.05 0.83 0.78 79 30 C1 117.6 SAT_311-DB 3 NEW Best * 1.72 0.45 0.92 0.47 56 31 C1 173.0 Satt338 3 Best * 1.49 0.24 0.67 0.43 47 32 C2 28.6 SATT640-TB 3 NEW Best * 1.50 0.57 0.98 0.41 45 36 C2 140.9 Satt557 5 Best ** 2.68 0.61 1.00 0.28 84 36 C2 145.8 Satt319 1 * 1.66 0.72 1.00 0.28 84 36.5 C2 153.5 SAT_142-DB 3 NEW Best ** 2.44 0.58 1.00 0.42 62 40 D1a 54.7 Satt321 2 Best * 1.52 0.17 0.64 0.47 82 42 D1a 73.1 Satt203 4 Best * 1.54 0.07 0.42 0.35 76 43 D1a 129.2 Satt129 5 Best ** 3.52 0.36 0.99 0.63 75 43 D1a 129.2 Satt147 1 * 1.85 0.70 1.00 0.30 63 45 D1b 19.1 SAT_351 3 NEW Best ** 2.08 0.14 0.73 0.59 66 45 D1b 20.0 P10621B-2 2 NEW * 1.51 0.60 0.96 0.36 86 46 D1b 36.7 Satt701 2 NEW Best * 1.97 0.15 0.59 0.44 27 46 D1b 39.8 Satt634 3 NEW * 1.40 0.44 0.89 0.45 27 53 D2 66.9 Satt582 2 Best * 1.33 0.06 0.37 0.31 78 54 D2 93.8 Satt389 6 Best * 1.35 0.11 0.48 0.37 81 55 D2 110.4 Satt464 1 Best ** 4.00 0.05 0.75 0.70 83 55 D2 111.8 Satt662 1 NEW ** 2.08 0.06 0.65 0.59 27 57 D2 149.1 Satt672 1 NEW Best * 1.64 0.15 0.57 0.42 27 62 E 98.0 Satt573 2 * 1.83 0.45 0.92 0.47 61 62 E 98.0 Satt598 1 Best * 1.92 0.49 0.95 0.46 73 62 E 100.6 Satt263 2 * 1.42 0.11 0.49 0.38 58 62 E 102.2 Satt151 4 * 1.39 0.08 0.44 0.36 79 62 E 103.7 SAT_273-DB 1 NEW * 1.59 0.11 0.59 0.48 62 64 F 0.0 Satt146 1 ** 3.10 0.20 0.89 0.70 75 64 F 0.0 Satt193 3 ** 3.70 0.09 0.86 0.77 62 64 F 0.0 Satt569 3 ** 3.30 0.18 0.91 0.73 64 64 F 1.7 Satt343 3 Best ** 3.70 0.08 0.89 0.81 74 64 F 1.9 Satt586 5 ** 3.10 0.08 0.82 0.74 70 64 F 2.5 Satt040 4 ** 3.16 0.08 0.81 0.73 62 66 F 57.5 Satt595 1 NEW Best ** 2.35 0.69 1.00 0.31 75 67 F 95.0 Satt334 3 NEW Best * 1.55 0.15 0.63 0.48 73 70 F 157.8 Satt144 1 Best * 1.77 0.46 0.93 0.47 84 71 F 165.8 Satt522 5 Best * 1.32 0.06 0.37 0.31 77 73 G 7.7 Satt570 3 NEW Best ** 3.70 0.00 0.27 0.27 82 73 G 8.5 Satt356 2 Best * 1.30 0.68 0.98 0.30 62 77 G 100.8 Satt199 1 Best * 1.61 0.45 0.89 0.44 81 77 G 103.2 Satt517 4 * 1.59 0.07 0.51 0.44 58 79 G 137.0 Satt191 2 * 1.39 0.18 0.63 0.44 80 79 G 138.4 Sat_117 1 Best * 1.89 0.23 0.77 0.54 77 83 H 77.3 Satt279 6 NEW Best * 2.02 0.40 0.90 0.50 63 85 H 125.3 Satt181 5 Best ** 3.06 0.05 0.72 0.66 76 86 I 15.5 Satt127 2 Best ** 2.36 0.64 1.00 0.36 77 87 I 57.9 Satt270 12 NEW Best ** 2.28 0.00 0.04 0.04.dagger. 82 88 I 77.4 Satt292 3 NEW Best * 1.84 0.06 0.56 0.50 64 90 J 19.6 SAG1223 4 NEW Best ** 2.59 0.22 0.89 0.67 27 90 J 26.4 SAC1699 3 NEW ** 1.96 0.04 0.62 0.58 74 91.5 J 61.3 Sat_065 2 Best ** 4.00 0.23 0.96 0.73 65 91.5 J 63.6 Satt596 4 * 1.77 0.24 0.80 0.56 64 92 J 68.0 Satt406 2 ** 3.05 0.19 0.89 0.70 77 92 J 70.8 Satt380 3 ** 2.80 0.29 0.91 0.63 69 92 J 72.6 Satt183 1 ** 2.52 0.43 0.96 0.53 84 92 J 74.4 Satt529 1 Best ** 3.22 0.43 0.99 0.56 73 94 K 17.9 Satt242 4 Best ** 3.05 0.07 0.71 0.64 65 97 K 83.7 Satt617 6 NEW Best * 1.68 0.08 0.60 0.53 24 97 K 85.8 Satt240 2 * 1.57 0.05 0.60 0.45 74 100 L 15.6 SAT_301 5 NEW Best * 1.97 0.22 0.83 0.61 78 101 L 33.9 Satt418 2 NEW * 1.44 0.56 0.94 0.37 63 101 L 34.6 Satt398 4 Best ** 3.22 0.34 0.94 0.61 71 102 L 42.3 Satt497 3 NEW Best * 1.66 0.60 0.96 0.36 78 103 L 77.1 Satt166 3 Best ** 3.22 0.11 0.86 0.75 80 103 L 78.0 Satt448 4 * 1.80 0.22 0.74 0.52 65 104 L 118.0 Satt373 3 Best ** 4.00 0.02 0.44 0.42 79 104 L 118.6 Satt513 5 ** 2.51 0.02 0.24 0.22.dagger. 64 104 L 124.5 P12394A-1 2 ** 2.64 0.68 1.00 0.32 85 107 M 84.2 SAG1048 2 NEW Best ** 4.00 0.01 0.69 0.68 76 108 M 87.6 Satt536 4 ** 2.12 0.12 0.69 0.58 83 108 M 91.1 Satt175 5 * 1.76 0.18 0.75 0.57 78 108 M 98.1 Satt677 2 NEW * 1.34 0.56 0.96 0.40 28 108 M 100.5 Satt680 2 NEW Best ** 3.22 0.13 0.86 0.73 71 109 M 115.0 P10615A-1 1 Best * 1.96 0.09 0.58 0.50 85 109 M 127.3 Satt551 3 NEW * 1.62 0.04 0.49 0.45 59 111 M 180.5 SAT_330-DB 1 NEW Best ** 3.00 0.16 0.85 0.69 61 112 N 20.0 P13069A-1 3 Best ** 4.00 0.00 0.44 0.44 84 112 N 25.0 P5467A-1 2 NEW ** 4.00 0.00 0.45 0.45 83 112 N 25.0 P5467A-2 1 * 1.72 0.21 0.63 0.42 86 113 N 38.3 SAT_084 2 NEW * 1.37 0.13 0.55 0.42 68 113 N 40.2 SAT_275-DB 2 NEW Best * 1.89 0.17 0.73 0.55 62 115 N 83.4 Satt660 2 NEW ** 2.34 0.10 0.77 0.67 28 115 N 88.6 Satt339 5 Best ** 2.44 0.17 0.77 0.60 80 118 O 2.4 Satt358 2 ** 2.35 0.03 0.44 0.41 75 118 O 6.3 Satt487 1 ** 2.33 0.00 0.02 0.02.dagger. 84 118 O 6.3 Satt487 4 Best ** 2.30 0.37 0.89 0.52 84 120 O 60.5 Satt420 2 Best * 1.95 0.33 0.85 0.52 84 120 O 65.1 Satt576 4 * 1.49 0.20 0.74 0.54 54 120 O 68.9 Satt633 1 NEW * 1.40 0.25 0.72 0.47 27 123 O 125.0 Satt581 2 Best ** 2.31 0.35 0.89 0.54 85 124 O 153.3 Satt153 3 Best ** 2.75 0.49 0.96 0.47 84 124 O 155.1 Satt243 1 * 1.82 0.61 0.97 0.36 68 UM UM P10793A-1 2 * 1.40 0.10 0.52 0.43 86 UM UM P13560A-1 1 * 1.42 0.22 0.60 0.38 86 UM UM P13561A-1 2 ** 2.51 0.64 1.00 0.36 82 UM UM S60021-TB 1 NEW * 1.32 0.53 0.95 0.41 28 UM UM S60048-TB 2 NEW ** 2.00 0.60 1.00 0.40 28 UM UM S60076-TB 1 NEW * 1.35 0.59 0.93 0.34 28 UM UM S60148-TB 2 NEW ** 2.22 0.52 0.96 0.45 28 UM UM S60149-TB 1 NEW * 1.46 0.36 0.86 0.50 28 UM UM S60201-TB 1 NEW ** 2.35 0.24 0.89 0.65 28 UM UM S60243-TB 3 NEW ** 2.92 0.27 0.93 0.66 28 UM UM S60326-TB 2 NEW ** 2.11 0.43 0.96 0.54 27 UM UM S60338-TB 1 NEW ** 2.60 0.51 1.00 0.49 25 UM UM S60350-TB 3 NEW ** 2.64 0.08 0.75 0.67 26 UM UM S60361-TB 2 NEW ** 3.22 0.14 0.88 0.74 25 UM UM S60422-TB 1 NEW ** 2.17 0.52 1.00 0.48 27 UM UM S60440-TB 2 NEW * 1.63 0.06 0.59 0.53 28 UM UM S60446-TB 2 NEW ** 2.80 0.51 1.00 0.49 28 UM UM S60505-TB 1 NEW ** 2.03 0.51 1.00 0.49 26 UM UM S60513-TB 2 NEW * 1.70 0.52 0.96 0.45 28 UM UM S60519-TB 2 NEW ** 3022 0.44 1.00 0.56 28 UM UM S60536-TB 1 NEW ** 2.64 0.43 1.00 0.57 28 UM UM S60552-TB 2 NEW * 1.69 0.31 0.88 0.56 28 UM UM S60585-TB 4 NEW * 1.45 0.56 0.96 0.40 27 UM UM S60630-TB 3 NEW * 1.48 0.32 0.89 0.57 26 UM UM S60728-TB 3 NEW * 1.46 0.45 0.91 0.46 28 UM UM S60812-TB 1 NEW * 1.51 0.40 0.87 0.47 27 UM UM SAC1677 3 ** 2.85 0.16 0.82 0.66 84 UM UM SAC1724 3 NEW * 1.49 .64 1.00 0.36 27 UM UM SAG1055 5 NEW * 1.62 0.65 1.00 0.35 28 UM UM Satt111 3 ** 4.00 .40 0.90 .80 83 UM UM Satt219 4 NEW * 1.42 0.05 0.42 0.37 80 UM UM Satt299 10 NEW * 1.38 0.65 0.35 0.30 79 * 95% significance level ** 99% significance level .dagger.LOD greater than 2.0, increase in frequency less than 25%.

TABLE-US-00013 TABLE 13 Favorable Alleles in A3127 Probability of Parent 1 Parent 2 inheriting "+" Chromosome Position Allele WILLIAMS ESSEX Progeny A3127 allele A1 19.1 1 - + + 0.5 A1 27.1 3 + - + 0.5 A2 0.0 1 - + + 0.5 A2 184.0 4 + - + 0.5 B2 45.0 2 + - + 0.5 C1 99.0 4 - + + 0.5 C2 140.9 5 + - + 0.5 D1a 129.2 5 + - + 0.5 D2 93.8 6 - + 0.5 D2 110.4 1 - + + 0.5 E 98.0 1 - + + 0.5 F 1.7 3 + - + 0.5 F 85.0 1 + - + 0.5 G 100.8 1 - + + 0.5 H 125.3 5 + - + 0.5 J 68.0 2 not segregating K 17.9 4 + - + 0.5 L 34.6 4 not segregating L 77.1 3 + - + 0.5 L 124.5 2 not segregating M 87.6 4 - + + 0.5 N 20.0 3 not segregating O 6.3 4 not segregating O 37.7 4 not segregating O 60.5 2 not segregating O 125.0 2 + - + 0.5 O 153.3 3 + - + 0.5 UM # 2 + - + 0.5 UM # 3 - + + 0.5 UM # 3 - + + 0.5 # of "+" 13 10 all 23 0.000000119 alleles .fwdarw. chance of this happening by chance = 1 in 8,388,608

TABLE-US-00014 TABLE 14 # of SATT591 SATT429 SATT144 SATT270 SATT529 SATT166 sublines Elite line segregating alleles at the above marker loci ***91B91 1 and 2 3 and 5 4 92M70 1 and 2 2 and 5 4 92B05 3 and 4 2 93B01 1 and 3 2 93M80 5 and 12 2 93M90 1 and 3 2

TABLE-US-00015 TABLE 15 Isoline seed yield means from field tests Statistical grouping # of plants Mean Yield Genotype (allele) bulked to Seed advantage of Original Subline at indicated marker form # of reps Yield better subline Elite Line Name locus Isoline (locations) (bu/ac) (bu/ac and %) LSD (0.05) = SATT529 SATT166 2.30 91B91 91B91-13 1 3 42 7 37.5 A 91B91 91B91-15 1 5 24 7 38.0 A 91B91 91B91-23 2 3 14 7 38.8 A 91B91 91B91-25 2 5 7 7 37.2 A LSD (0.05) = SATT144 SATT270 3.48 92M70 92M70-12 1 2 14 10 43.4 A 92M70 92M70-15 1 5 46 10 44.4 A 92M70 92M70-22 2 2 13 10 43.0 A 92M70 92M70-25 2 5 15 10 43.8 A LSD (0.05) = SATT429 2.01 92B05 92B05-3 3 175 5 37.0 A 92B05 92B05-4 4 116 5 37.0 A LSD (0.05) = SATT591 1.71 93B01 93B01-1 1 51 13 38.0 B 93B01 93B01-3 3 28 13 40.1 A 2.1 bu = 5.4% LSD (0.05) = SATT270 2.54 93M80 93M80-12 12 5 14 48.5 B 93M80 93M80-5 5 4 14 51.3 A 2.8 bu = 5.6% LSD (0.05) = SATT591 2.16 93M90 93M90-1 1 38 14 50.2 A 3.0 bu = 6.2% 93M90 93M90-3 3 47 14 47.2 B

TABLE-US-00016 APPENDIX I Allele Definition Table 23 pages Marker Allele Size Range bp Sac1006 1 91.54 92.48 Sac1006 2 93.67 94.41 Sac1006 3 105.49 106.22 Sac1677 1 191.96 192.46 Sac1677 2 193.94 194.93 Sac1677 3 205.90 206.91 Sac1677 4 332.86 333.35 Sac1677 5 190.20 190.40 Sac1677 6 204.40 204.60 Sat_084 1 151.69 152.30 Sat_084 2 153.28 154.30 Sat_084 3 157.85 158.85 Sat_084 4 163.84 164.82 Sat_084 5 172.09 172.56 Sat_084 6 160.26 160.46 Sat_090 1 336.52 337.36 Sat_090 2 349.84 350.92 Sat_090 3 355.55 356.29 Sat_090 4 338.64 339.23 Sat_090 5 340.79 340.09 Sat_090 6 348.04 348.57 Sat_090 7 351.54 352.37 Sat_090 8 353.79 354.12 Sat_090 9 357.22 357.86 Sat_104 1 266.36 267.50 Sat_104 2 284.72 285.73 Sat_110 1 165.79 166.96 Sat_110 2 179.85 180.32 Sat_110 3 181.88 183.02 Sat_110 4 183.72 184.58 Sat_110 5 185.65 186.71 Sat_110 6 187.88 188.05 Sat_117 1 210.34 211.45 Sat_117 2 218.15 219.41 Sat_117 3 220.13 221.05 Sat_117 4 226.19 226.96 Sat_117 5 232.64 232.99 Sat_117 6 212.76 213.12 Sat_117 7 216.86 217.25 Sat_117 8 222.62 222.99 Sat_117 9 224.83 224.93 Sat_117 10 242.75 242.85 Sat_117 11 252.02 252.23 Sat_117 12 255.97 256.17 Sat_117 13 203.20 203.35 Sat_117 14 208.93 209.13 Sat_117 15 234.70 234.90 Satt020 1 147.56 148.62 Satt020 2 160.10 160.87 Satt040 1 317.25 318.26 Satt040 2 323.30 324.31 Satt040 3 326.83 327.81 Satt040 4 329.75 330.66 Satt040 5 332.71 333.35 Satt040 6 320.28 321.05 Satt040 7 335.83 336.33 Satt040 8 308.03 308.53 Satt040 9 338.89 339.09 Satt040 10 314.39 314.69 Satt042 1 148.26 149.12 Satt042 2 157.59 158.45 Satt042 3 160.69 161.67 Satt042 4 163.71 164.64 Satt042 5 154.82 155.22 Satt042 6 160.26 160.46 Satt042 7 166.96 167.56 Satt042 8 135.78 135.98 Satt042 9 145.41 145.61 Satt050 1 221.60 222.79 Satt050 2 224.66 225.89 Satt050 3 239.80 240.68 Satt050 4 252.17 253.84 Satt050 5 255.27 255.57 Satt066 1 160.87 161.87 Satt066 2 105.74 106.69 Satt066 3 166.76 167.07 Satt066 4 169.95 171.12 Satt066 5 110.96 112.11 Satt066 6 151.75 152.78 Satt066 7 155.32 155.84 Satt066 8 158.20 158.86 Satt066 9 164.34 164.82 Satt066 10 168.42 169.19 Satt066 11 173.11 174.03 Satt066 12 176.16 176.93 Satt066 13 148.64 149.67 Satt066 14 117.63 118.13 Satt092 1 340.69 341.13 Satt092 2 349.07 350.92 Satt092 3 332.36 333.35 Satt092 4 338.79 339.25 Satt092 5 341.43 342.56 Satt092 6 353.17 353.29 Satt102 1 160.36 161.37 Satt102 2 175.43 176.43 Satt102 3 172.56 173.53 Satt102 4 178.87 179.35 Satt102 5 181.79 182.25 Satt102 6 184.58 185.65 Satt108 1 169.96 171.12 Satt108 2 173.06 174.00 Satt108 3 175.96 177.00 Satt108 4 167.15 167.92 Satt108 5 161.77 161.97 Satt108 6 149.12 149.22 Satt109 1 146.99 148.06 Satt109 2 164.62 165.54 Satt109 3 167.65 168.42 Satt109 4 162.27 162.47 Satt109 5 144.05 144.33 Satt111 1 254.76 255.57 Satt111 2 257.79 258.83 Satt111 3 260.76 261.78 Satt111 4 263.82 264.54 Satt111 5 278.98 280.09 Satt111 6 285.22 285.73 Satt111 7 288.24 288.75 Satt111 8 266.88 267.90 Satt111 9 270.13 270.33 Satt111 10 276.28 276.85 Satt111 11 248.80 249.00 Satt115 1 218.67 219.88 Satt115 2 236.35 237.83 Satt115 3 239.29 240.78 Satt115 4 242.65 243.20 Satt115 5 221.82 222.22 Satt115 6 238.31 238.51 Satt122 1 234.40 235.37 Satt122 2 282.65 283.26 Satt122 3 291.75 292.40 Satt127 1 241.61 242.25 Satt127 2 244.22 245.31 Satt127 3 232.44 233.10 Satt127 4 238.81 239.29 Satt127 5 247.60 248.20 Satt127 6 250.71 251.22 Satt129 1 120.97 122.06 Satt129 2 133.16 134.38 Satt129 3 136.28 137.33 Satt129 4 149.22 150.17 Satt129 5 152.23 153.28 Satt129 6 155.84 156.34 Satt129 8 127.42 128.08 Satt129 9 140.02 140.52 Satt129 10 143.25 143.75 Satt129 11 132.05 132.25 Satt130 1 142.17 143.25 Satt130 2 147.44 148.62 Satt130 3 150.62 151.75 Satt130 4 154.30 154.82 Satt131 1 157.85 159.25 Satt131 2 173.06 174.03 Satt131 3 175.96 176.93 Satt131 4 179.35 179.85 Satt131 5 182.16 182.75 Satt131 6 148.62 149.67 Satt133 1 163.80 164.82 Satt133 2 181.99 182.85 Satt133 3 167.36 167.56 Satt133 4 176.06 176.26 Satt133 5 172.96 173.41 Satt138 1 226.66 227.82 Satt138 2 229.84 230.75 Satt138 3 232.85 233.82 Satt138 4 235.30 236.56 Satt138 5 241.66 242.45 Satt138 6 231.47 231.87 Satt138 7 238.91 239.11 Satt138 8 214.97 215.17 Satt142 1 122.55 123.25 Satt142 2 137.89 138.69 Satt142 3 141.10 142.17 Satt142 4 144.33 145.41 Satt142 5 156.34 156.94 Satt142 6 148.06 148.16 Satt142 7 108.04 108.20 Satt142 8 129.00 129.20 Satt144 1 210.72 212.56 Satt144 2 227.62 228.58 Satt144 3 231.25 231.40 Satt146 1 291.11 292.36 Satt146 2 294.26 295.32 Satt146 3 309.55 310.57 Satt146 4 313.02 314.06 Satt146 5 316.11 317.50 Satt146 7 306.71 307.71 Satt146 8 298.10 298.30 Satt146 9 319.97 320.38 Satt146 10 322.80 323.30 Satt146 11 329.37 329.87 Satt146 12 331.75 332.66 Satt146 13 334.84 335.83 Satt147 1 176.73 177.70 Satt147 2 182.75 183.52 Satt147 3 193.45 195.03 Satt147 4 179.95 180.52 Satt147 5 207.01 208.72 Satt147 6 211.35 211.55 Satt147 7 213.90 214.77 Satt147 8 216.95 217.55 Satt147 9 199.29 199.49 Satt150 1 246.11 248.00 Satt150 2 249.20 249.70 Satt150 3 267.70 267.90 Satt150 4 270.95 271.05 Satt150 5 282.55 283.21 Satt150 6 234.18 234.60 Satt150 7 237.33 237.63 Satt151 1 169.04 170.15 Satt151 2 178.06 179.35 Satt151 3 184.04 185.15 Satt151 4 187.08 188.05 Satt151 5 205.40 206.40 Satt151 6 166.29 166.76 Satt151 7 175.46 175.96 Satt151 8 198.89 199.39 Satt153 1 198.39 199.49 Satt153 2 201.39 202.09 Satt153 3 213.47 214.57 Satt153 4 231.30 232.17 Satt153 5 220.13 220.53 Satt155 1 151.75 152.78 Satt155 2 160.87 162.37 Satt155 3 163.84 165.02 Satt155 4 167.11 167.72 Satt155 5 158.35 158.45 Satt155 6 148.82 149.12 Satt155 7 197.50 197.90 Satt156 1 326.12 326.84 Satt156 2 329.20 330.02 Satt156 3 343.89 344.85 Satt156 4 349.65 350.00 Satt156 5 346.68 347.11 Satt159 1 268.90 269.53 Satt159 2 269.73 270.33 Satt159 3 271.94 272.78 Satt159 4 287.23 287.74 Satt159 5 290.25 290.95 Satt165 1 210.44 211.45 Satt165 2 213.37 214.63 Satt165 3 219.41 220.48 Satt165 4 216.55 216.95 Satt165 5 204.70 204.90 Satt165 6 225.69 225.99

Satt166 1 187.08 188.10 Satt166 2 220.48 221.35 Satt166 3 226.44 227.62 Satt166 4 229.48 230.24 Satt166 5 232.37 233.67 Satt166 6 223.39 223.76 Satt166 7 217.35 217.75 Satt168 1 345.94 346.71 Satt168 2 359.98 360.77 Satt168 3 362.95 363.65 Satt168 4 365.87 367.16 Satt168 5 368.83 369.34 Satt168 6 335.26 336.00 Satt168 7 311.10 311.30 Satt168 8 329.57 329.77 Satt172 1 155.84 156.89 Satt172 2 167.72 168.52 Satt172 3 170.62 171.52 Satt172 4 179.35 180.32 Satt172 5 182.25 183.22 Satt175 1 160.21 161.37 Satt175 2 163.31 164.54 Satt175 3 166.29 166.96 Satt175 4 169.19 170.50 Satt175 5 178.30 179.55 Satt175 6 193.45 194.74 Satt175 7 172.76 173.26 Satt175 8 175.61 176.26 Satt175 9 188.05 188.60 Satt175 10 190.98 191.96 Satt175 11 181.69 181.89 Satt176 1 138.39 139.15 Satt176 2 141.60 142.77 Satt176 3 160.36 162.37 Satt176 4 169.68 170.77 Satt176 5 172.49 173.68 Satt176 6 187.65 188.85 Satt176 7 148.16 149.02 Satt176 8 163.55 164.67 Satt176 9 175.56 176.63 Satt176 10 181.62 182.75 Satt181 1 324.31 325.37 Satt181 2 346.28 347.16 Satt181 3 354.62 355.60 Satt181 4 357.67 358.46 Satt181 5 363.01 364.30 Satt181 6 351.94 352.47 Satt181 7 360.53 361.17 Satt181 8 366.01 367.16 Satt181 9 349.07 349.55 Satt183 1 122.04 123.05 Satt183 2 128.08 129.10 Satt183 3 144.83 145.91 Satt183 4 148.16 148.62 Satt183 5 131.43 131.85 Satt183 6 135.26 135.78 Satt183 7 138.49 138.95 Satt183 8 141.70 141.90 Satt186 1 361.81 363.07 Satt186 2 364.72 365.94 Satt186 3 367.87 368.83 Satt186 4 339.25 341.09 Satt186 5 359.30 359.73 Satt186 6 371.22 371.72 Satt186 7 373.74 374.61 Satt186 8 376.96 377.46 Satt186 9 353.39 353.59 Satt190 1 187.01 188.06 Satt190 2 193.35 194.10 Satt190 3 196.42 197.40 Satt190 4 225.99 227.06 Satt190 5 181.17 182.03 Satt190 6 184.18 184.68 Satt190 7 190.50 190.98 Satt190 8 220.38 220.85 Satt190 9 214.07 214.57 Satt191 1 319.67 320.28 Satt191 2 334.84 336.02 Satt191 3 337.81 339.02 Satt191 4 349.07 350.00 Satt191 5 352.14 352.77 Satt191 6 354.62 355.65 Satt191 7 360.69 361.17 Satt191 8 346.68 346.71 Satt193 1 165.79 166.76 Satt193 2 168.94 169.65 Satt193 3 174.59 175.96 Satt193 4 180.77 181.79 Satt193 5 186.61 187.75 Satt193 6 189.97 190.60 Satt193 7 192.95 193.75 Satt193 8 198.89 199.89 Satt193 9 202.19 203.40 Satt193 10 183.72 185.15 Satt193 11 171.79 173.06 Satt193 12 160.11 161.37 Satt193 13 177.85 179.08 Satt193 14 163.36 163.84 Satt195 1 214.77 216.11 Satt195 2 217.93 218.91 Satt195 3 221.65 222.22 Satt196 1 230.04 230.50 Satt196 2 232.94 233.52 Satt196 3 239.29 239.79 Satt196 4 241.76 243.00 Satt196 5 253.84 255.27 Satt196 6 236.17 236.45 Satt196 7 257.51 257.81 Satt196 8 263.52 263.92 Satt197 1 177.50 179.35 Satt197 2 184.18 185.15 Satt197 3 187.08 188.55 Satt197 4 190.00 191.48 Satt197 5 192.95 194.44 Satt197 6 205.65 206.00 Satt197 7 170.35 170.72 Satt197 8 175.44 175.96 Satt197 9 166.96 167.71 Satt197 10 181.59 181.79 Satt199 1 161.84 162.86 Satt199 2 202.22 204.40 Satt199 3 166.29 166.76 Satt199 4 168.22 168.69 Satt199 5 174.03 174.99 Satt199 6 178.37 178.87 Satt199 7 220.85 221.35 Satt199 8 176.01 176.16 Satt199 9 170.20 170.60 Satt202 1 306.48 307.51 Satt202 2 309.55 310.72 Satt202 3 287.33 287.79 Satt202 4 313.03 313.66 Satt202 5 285.22 285.93 Satt203 1 223.29 224.06 Satt203 2 229.53 230.04 Satt203 3 249.20 250.00 Satt203 4 258.33 259.34 Satt203 5 205.40 205.90 Satt203 6 212.56 212.76 Satt203 7 219.61 219.81 Satt203 8 226.51 227.82 Satt203 9 231.30 231.67 Satt204 1 234.88 235.87 Satt204 2 240.78 241.76 Satt204 3 247.00 248.20 Satt204 4 250.00 250.76 Satt204 5 253.03 253.79 Satt204 6 238.13 238.31 Satt204 7 256.59 256.79 Satt209 1 311.80 312.63 Satt209 2 329.37 330.48 Satt209 3 310.77 311.10 Satt212 1 347.13 348.73 Satt212 2 355.42 356.49 Satt212 3 358.66 358.80 Satt213 1 326.34 327.35 Satt213 2 318.46 318.66 Satt216 1 195.43 196.42 Satt216 2 198.79 199.39 Satt216 3 222.79 223.29 Satt216 4 225.69 226.66 Satt216 5 210.95 211.45 Satt216 6 216.95 217.45 Satt216 7 220.18 220.38 Satt218 1 341.13 342.16 Satt218 2 344.12 344.85 Satt219 1 126.38 127.07 Satt219 2 141.95 142.67 Satt219 3 157.69 158.55 Satt219 4 175.46 176.58 Satt219 5 120.38 120.77 Satt219 6 154.82 155.12 Satt219 7 160.97 161.37 Satt219 8 172.80 173.46 Satt219 9 178.78 179.55 Satt219 10 182.09 182.45 Satt220 1 337.71 338.29 Satt220 2 340.39 341.23 Satt220 3 343.24 344.42 Satt220 4 346.28 346.71 Satt220 5 334.54 334.94 Satt220 6 354.62 355.02 Satt220 7 360.23 360.63 Satt220 8 352.52 352.57 Satt221 1 228.12 229.08 Satt221 2 234.12 234.90 Satt221 3 237.33 238.31 Satt221 4 246.50 247.50 Satt221 5 231.20 231.47 Satt225 1 99.95 101.41 Satt225 2 102.87 103.93 Satt225 3 109.05 110.01 Satt227 1 327.28 328.73 Satt227 2 333.35 334.55 Satt228 1 293.26 294.26 Satt228 2 298.30 299.06 Satt228 3 310.00 310.57 Satt228 4 323.40 324.31 Satt228 5 326.44 327.35 Satt228 6 329.61 330.88 Satt228 7 317.45 317.65 Satt228 8 341.53 341.73 Satt230 1 226.14 227.26 Satt230 2 229.33 230.50 Satt230 3 231.97 232.99 Satt230 4 214.97 215.47 Satt230 5 223.39 224.26 Satt233 1 90.83 91.34 Satt233 4 91.64 92.40 Satt233 5 97.75 98.46 Satt233 6 103.73 105.25 Satt233 7 112.77 113.66 Satt234 1 175.32 176.21 Satt234 2 178.35 179.35 Satt234 3 172.96 173.06 Satt236 1 250.00 250.81 Satt236 2 255.77 256.79 Satt236 3 259.08 259.84 Satt236 4 262.16 262.95 Satt236 5 265.46 265.66 Satt236 6 271.35 271.56 Satt236 7 253.39 253.84 Satt240 1 310.07 311.30 Satt240 2 313.16 314.63 Satt240 3 316.44 317.86 Satt240 4 319.60 320.48 Satt240 5 326.34 326.54 Satt242 1 182.25 183.22 Satt242 2 191.48 192.46 Satt242 3 197.40 198.39 Satt242 4 200.39 201.52 Satt242 5 203.25 204.40 Satt242 6 209.43 210.44 Satt242 7 212.91 213.47 Satt242 8 167.72 168.22 Satt242 9 179.85 180.32 Satt242 10 188.55 189.02 Satt242 11 194.93 195.43 Satt242 12 206.91 207.41 Satt242 13 185.65 186.11 Satt242 14 171.94 172.29 Satt242 15 175.09 175.34 Satt242 16 181.17 181.22 Satt242 17 196.12 196.27 Satt243 1 334.69 335.83 Satt243 2 343.48 344.47 Satt243 3 363.37 364.48 Satt243 4 366.24 366.91 Satt243 5 357.96 358.16 Satt243 6 337.76 338.69 Satt243 7 346.58 347.06

Satt243 8 349.47 349.60 Satt247 1 363.62 365.08 Satt247 2 369.29 370.70 Satt247 3 375.25 376.51 Satt247 4 366.63 367.67 Satt247 5 373.15 373.35 Satt247 6 381.11 382.25 Satt247 7 378.30 378.50 Satt247 8 355.25 355.45 Satt249 1 217.90 218.73 Satt249 2 220.85 221.65 Satt249 3 251.19 252.23 Satt249 4 257.31 258.33 Satt249 5 254.61 255.06 Satt249 6 260.96 261.38 Satt249 7 236.75 236.95 Satt250 1 189.02 190.00 Satt250 2 207.16 208.02 Satt250 3 228.68 228.98 Satt250 4 213.87 213.97 Satt250 5 219.41 219.61 Satt251 1 215.92 216.95 Satt251 2 218.91 219.41 Satt251 3 254.26 255.27 Satt251 4 257.81 259.08 Satt251 5 266.48 267.50 Satt251 6 209.77 210.95 Satt251 7 260.86 261.38 Satt251 8 212.97 213.97 Satt251 9 272.98 273.18 Satt255 1 236.85 237.43 Satt255 2 242.75 243.33 Satt255 3 245.71 246.70 Satt255 4 248.70 249.30 Satt256 1 338.99 340.19 Satt256 2 348.27 349.50 Satt256 3 351.28 352.27 Satt257 1 255.20 256.29 Satt257 2 267.33 268.52 Satt257 3 242.25 243.15 Satt257 4 249.20 250.41 Satt257 5 258.48 259.74 Satt257 6 261.78 262.18 Satt258 1 156.62 157.69 Satt258 2 159.71 160.71 Satt258 3 161.37 161.87 Satt258 4 162.82 163.84 Satt258 5 165.79 166.76 Satt258 6 168.22 168.42 Satt259 1 187.08 188.15 Satt259 2 193.45 194.44 Satt259 3 205.40 206.50 Satt259 4 207.65 209.58 Satt259 5 211.82 212.64 Satt262 1 231.97 232.94 Satt262 2 244.38 245.21 Satt262 3 247.20 248.20 Satt262 4 250.21 251.22 Satt262 5 256.29 257.31 Satt262 6 241.41 242.06 Satt262 7 253.42 254.04 Satt262 8 235.67 235.87 Satt263 1 249.53 250.21 Satt263 2 252.43 253.44 Satt263 3 267.70 268.72 Satt263 4 276.75 278.02 Satt263 5 289.18 290.10 Satt263 6 255.72 256.29 Satt263 7 265.04 265.46 Satt263 8 271.56 271.76 Satt263 9 246.44 247.20 Satt264 1 216.38 217.45 Satt264 2 219.35 220.38 Satt264 3 228.41 229.54 Satt264 4 237.33 238.46 Satt264 5 246.65 247.70 Satt264 6 243.63 244.72 Satt265 1 264.64 265.96 Satt265 2 267.88 268.52 Satt265 3 285.98 286.93 Satt265 4 289.35 289.55 Satt265 5 258.93 259.54 Satt265 6 262.18 262.40 Satt265 7 283.11 283.41 Satt266 1 321.79 323.05 Satt266 2 330.98 332.32 Satt266 3 303.20 303.93 Satt267 1 232.44 233.42 Satt267 2 241.46 242.25 Satt267 3 250.61 251.32 Satt267 4 244.82 245.21 Satt267 5 247.80 248.00 Satt270 1 110.46 110.96 Satt270 2 119.10 119.98 Satt270 3 140.97 141.60 Satt270 4 141.86 142.67 Satt270 5 144.05 144.98 Satt270 6 150.65 151.28 Satt270 7 116.20 116.71 Satt270 8 125.06 125.56 Satt270 9 128.60 129.10 Satt270 10 147.56 148.06 Satt270 11 154.31 155.32 Satt270 12 156.61 157.34 Satt272 1 223.76 225.23 Satt272 2 229.94 231.00 Satt272 3 226.94 228.12 Satt272 4 233.42 233.92 Satt272 5 242.25 242.75 Satt272 6 247.20 247.70 Satt274 1 195.33 196.32 Satt274 2 198.38 199.44 Satt274 3 201.34 202.44 Satt274 4 204.40 205.40 Satt274 5 180.25 180.52 Satt274 6 189.42 189.62 Satt274 7 207.45 208.72 Satt279 1 174.83 175.76 Satt280 1 230.04 231.05 Satt280 2 180.92 181.79 Satt280 2 233.19 233.92 Satt280 3 236.17 236.90 Satt280 4 202.69 203.00 Satt280 5 224.29 224.98 Satt282 1 314.04 314.79 Satt282 2 317.12 318.31 Satt282 3 326.34 327.85 Satt282 4 192.95 193.65 Satt282 4 332.51 334.05 Satt282 5 335.68 336.92 Satt282 6 347.84 348.04 Satt282 7 323.45 324.31 Satt282 8 329.67 330.58 Satt282 9 338.88 339.75 Satt282 10 310.67 311.70 Satt284 1 115.70 116.66 Satt284 2 124.56 125.61 Satt284 3 127.95 128.70 Satt284 4 119.20 119.30 Satt284 5 112.86 113.06 Satt284 6 198.89 199.89 Satt284 6 129.40 129.61 Satt285 1 208.93 210.19 Satt285 2 231.97 232.95 Satt285 3 235.51 236.36 Satt285 4 241.26 242.50 Satt285 5 243.73 245.41 Satt285 6 206.40 206.80 Satt285 7 187.28 187.48 Satt285 7 229.32 230.34 Satt287 1 203.38 204.40 Satt287 2 233.55 234.40 Satt287 3 197.70 198.09 Satt287 4 243.15 243.53 Satt287 9 205.60 205.70 Satt292 1 221.35 221.82 Satt292 2 224.26 225.23 Satt292 3 239.29 240.28 Satt292 4 242.66 243.23 Satt292 5 251.70 252.23 Satt292 6 229.18 229.48 Satt292 7 232.24 232.44 Satt292 8 211.25 211.55 Satt292 9 254.76 255.06 Satt292 10 257.91 258.21 Satt295 1 220.38 221.25 Satt295 2 223.29 224.26 Satt295 3 226.57 227.16 Satt295 4 232.44 233.14 Satt295 5 244.62 245.21 Satt295 6 256.73 257.41 Satt295 7 264.94 265.96 Satt295 8 208.82 209.03 Satt295 9 217.15 217.75 Satt295 11 235.62 236.02 Satt295 12 238.81 239.01 Satt295 13 241.66 241.91 Satt295 14 253.84 254.04 Satt299 1 258.01 258.21 Satt299 2 283.51 283.61 Satt299 3 284.01 284.97 Satt299 4 285.12 286.27 Satt299 5 291.25 292.30 Satt299 6 303.70 304.30 Satt299 7 306.88 307.51 Satt299 8 313.66 314.69 Satt299 9 318.76 319.47 Satt299 10 328.65 329.87 Satt299 11 331.87 332.81 Satt299 12 342.56 343.49 Satt299 13 293.26 293.36 Satt300 1 238.81 239.79 Satt300 2 245.20 245.81 Satt300 3 254.26 255.27 Satt300 4 266.48 267.23 Satt300 5 269.53 270.55 Satt300 6 242.25 242.85 Satt300 7 257.81 258.11 Satt300 8 263.57 263.82 Satt303 1 128.60 129.10 Satt303 2 131.59 132.15 Satt303 3 134.68 135.34 Satt303 4 137.82 138.39 Satt303 5 140.96 141.70 Satt303 6 144.13 144.88 Satt303 7 153.65 154.41 Satt303 8 156.67 157.49 Satt303 9 119.59 120.08 Satt303 10 122.75 123.05 Satt303 11 147.66 147.86 Satt303 12 159.96 160.16 Satt304 1 98.35 99.16 Satt304 2 162.75 163.84 Satt304 3 165.99 166.59 Satt304 4 168.81 169.65 Satt307 1 336.32 337.51 Satt307 2 350.42 351.44 Satt307 3 355.99 356.92 Satt307 4 358.93 360.82 Satt307 5 362.00 362.67 Satt307 6 365.33 365.84 Satt307 7 367.97 368.48 Satt311 1 152.78 153.81 Satt311 2 164.82 165.79 Satt311 3 175.96 176.43 Satt311 4 156.24 156.34 Satt311 5 192.37 192.47 Satt311 6 207.41 207.51 Satt311 7 201.44 201.89 Satt311 8 210.14 210.85 Satt311 9 181.29 181.69 Satt314 1 241.26 242.25 Satt314 2 244.22 245.21 Satt314 3 247.50 247.80 Satt319 1 173.31 174.59 Satt319 2 176.48 177.50 Satt319 3 179.47 180.52 Satt319 4 218.91 219.88 Satt319 5 237.16 238.13 Satt319 6 240.78 241.26 Satt319 7 183.22 183.32 Satt319 8 192.27 192.47 Satt319 9 210.44 210.95 Satt319 10 234.90 235.00 Satt321 1 231.97 233.25 Satt321 2 235.25 236.23 Satt321 3 238.31 239.26 Satt321 4 244.22 244.72 Satt322 1 313.03 313.81 Satt322 2 312.13 312.78 Satt326 1 323.68 324.81

Satt326 2 326.69 327.85 Satt326 3 329.87 330.88 Satt326 4 342.06 342.76 Satt326 5 320.83 321.39 Satt327 1 251.22 252.23 Satt327 2 254.26 255.28 Satt327 3 245.41 245.81 Satt327 4 248.55 248.80 Satt327 5 233.62 234.02 Satt327 6 263.72 263.92 Satt327 7 242.42 242.80 Satt327 8 257.51 257.66 Satt328 1 248.20 249.20 Satt328 2 251.22 252.23 Satt329 1 238.31 238.81 Satt329 2 268.52 269.53 Satt329 3 272.58 273.38 Satt329 4 275.63 276.65 Satt329 5 279.69 280.70 Satt329 6 247.20 247.70 Satt329 7 254.26 254.76 Satt329 8 257.31 258.33 Satt329 9 267.50 268.00 Satt329 10 277.25 277.45 Satt329 11 279.28 279.48 Satt329 12 274.00 274.10 Satt329 13 270.13 270.23 Satt330 1 308.03 308.78 Satt330 2 342.41 343.49 Satt330 3 348.04 348.72 Satt330 4 355.55 355.99 Satt330 5 364.02 364.78 Satt330 6 344.72 344.85 Satt330 7 345.50 345.98 Satt330 8 346.71 346.91 Satt330 9 316.53 316.93 Satt331 1 233.42 234.40 Satt331 2 239.67 240.28 Satt331 3 251.56 252.43 Satt331 4 236.95 237.15 Satt332 1 161.69 162.37 Satt332 2 176.57 177.90 Satt332 3 179.65 180.32 Satt332 4 182.85 183.20 Satt332 5 173.78 174.13 Satt333 1 180.32 180.82 Satt333 2 195.43 196.47 Satt333 3 198.89 199.39 Satt333 4 201.89 202.39 Satt333 5 204.74 205.40 Satt333 6 171.79 171.99 Satt333 7 189.82 190.00 Satt333 8 177.75 178.20 Satt333 9 192.76 193.10 Satt334 1 202.39 202.90 Satt334 2 207.92 208.93 Satt334 3 210.95 211.96 Satt334 4 214.33 215.77 Satt334 5 215.96 216.76 Satt334 6 217.93 218.70 Satt334 7 220.38 221.35 Satt334 8 196.12 196.32 Satt334 9 230.34 230.50 Satt335 1 145.31 146.49 Satt335 2 154.82 156.09 Satt335 3 164.34 165.27 Satt335 4 167.51 168.22 Satt335 5 170.55 171.27 Satt336 1 176.43 177.40 Satt336 2 182.53 183.22 Satt336 3 185.50 186.61 Satt336 4 191.48 192.46 Satt338 1 229.08 230.04 Satt338 2 232.54 233.92 Satt338 3 253.24 254.37 Satt338 4 265.46 266.68 Satt338 5 274.62 275.57 Satt338 6 277.67 278.68 Satt338 7 238.31 238.71 Satt338 8 280.90 281.90 Satt339 1 234.90 235.38 Satt339 2 240.47 241.97 Satt339 3 243.73 244.72 Satt339 4 255.91 257.31 Satt339 5 264.88 266.26 Satt339 6 268.14 269.07 Satt339 7 206.70 206.91 Satt339 8 252.83 253.92 Satt339 9 271.45 271.56 Satt339 10 250.21 250.61 Satt339 11 262.28 262.40 Satt339 12 259.13 259.35 Satt343 1 138.39 138.95 Satt343 2 141.50 142.37 Satt343 3 160.14 161.87 Satt343 4 169.19 169.87 Satt343 5 172.09 173.06 Satt343 6 187.08 188.05 Satt343 7 148.16 148.62 Satt343 8 181.12 181.99 Satt343 9 163.26 164.00 Satt343 10 175.46 175.86 Satt343 11 154.51 154.71 Satt346 1 321.29 322.30 Satt346 2 327.35 328.36 Satt346 3 336.32 337.41 Satt346 4 339.25 340.29 Satt346 5 318.20 319.27 Satt346 6 324.40 325.32 Satt347 1 345.25 346.28 Satt347 2 347.94 349.07 Satt347 3 351.02 351.84 Satt348 1 308.03 308.72 Satt348 2 333.01 333.85 Satt348 3 341.83 342.66 Satt348 4 344.67 345.35 Satt348 5 330.27 330.58 Satt348 6 326.84 327.35 Satt348 7 339.55 339.85 Satt352 1 334.54 335.83 Satt352 2 341.13 341.63 Satt352 3 346.15 347.21 Satt352 4 351.72 352.87 Satt352 5 354.62 355.55 Satt352 6 340.59 340.89 Satt352 7 343.79 343.92 Satt352 8 369.49 369.69 Satt352 9 349.17 349.80 Satt352 10 337.41 338.54 Satt352 11 360.53 360.63 Satt353 1 144.20 145.03 Satt353 2 159.86 160.87 Satt353 3 169.19 169.75 Satt353 4 174.94 175.96 Satt353 5 184.18 185.08 Satt353 6 178.37 178.97 Satt353 7 165.84 166.96 Satt353 8 154.30 154.50 Satt355 1 248.20 249.20 Satt355 2 257.22 258.33 Satt355 3 272.58 273.43 Satt355 4 236.35 237.33 Satt355 5 254.26 254.86 Satt355 6 269.53 270.03 Satt355 7 275.88 276.33 Satt355 8 278.88 279.28 Satt355 9 260.76 260.96 Satt356 1 322.24 323.30 Satt356 2 325.15 326.72 Satt357 1 171.69 173.06 Satt357 2 275.63 277.15 Satt357 3 278.60 280.19 Satt357 4 183.22 184.18 Satt357 5 198.70 199.39 Satt357 6 262.40 262.90 Satt357 7 269.53 270.03 Satt357 8 286.73 287.23 Satt358 1 194.93 196.42 Satt358 2 206.91 208.17 Satt358 3 209.94 210.95 Satt358 4 203.90 205.10 Satt358 5 164.82 166.29 Satt358 6 198.39 199.39 Satt358 7 162.85 163.84 Satt359 1 182.58 183.65 Satt359 2 184.68 186.00 Satt359 3 197.75 198.64 Satt359 4 200.89 201.39 Satt359 5 189.12 189.42 Satt359 6 203.80 204.50 Satt359 7 206.75 207.36 Satt359 8 164.82 165.27 Satt361 1 271.81 273.08 Satt361 2 274.95 275.93 Satt361 3 269.02 269.93 Satt361 4 278.07 278.78 Satt364 1 232.45 233.40 Satt364 2 235.38 236.18 Satt364 3 241.26 242.55 Satt364 4 244.22 245.41 Satt364 5 238.61 238.91 Satt364 6 229.54 229.74 Satt367 1 191.96 193.00 Satt367 2 212.97 214.07 Satt367 3 215.96 217.15 Satt367 4 221.82 223.09 Satt367 5 225.13 226.19 Satt367 6 228.12 229.18 Satt367 7 231.25 232.07 Satt367 8 195.58 195.83 Satt367 9 189.07 189.47 Satt367 10 234.70 234.80 Satt367 11 196.72 197.10 Satt367 12 210.34 210.64 Satt369 1 234.60 236.18 Satt369 2 236.65 237.33 Satt369 3 239.55 240.78 Satt369 4 242.51 243.73 Satt369 5 218.43 219.06 Satt369 6 227.53 228.02 Satt369 7 231.00 231.20 Satt369 8 245.63 246.11 Satt372 1 336.98 338.29 Satt372 2 340.05 341.13 Satt372 3 345.78 346.28 Satt372 4 348.57 349.17 Satt372 5 351.34 352.27 Satt372 6 334.15 334.54 Satt372 7 350.52 350.62 Satt372 8 306.08 306.58 Satt373 1 143.25 143.75 Satt373 2 146.49 147.09 Satt373 3 149.52 150.27 Satt373 4 158.75 159.51 Satt373 5 179.85 180.32 Satt373 6 182.70 183.72 Satt373 7 212.97 213.47 Satt373 8 152.78 153.28 Satt373 9 155.72 156.54 Satt373 10 173.73 174.43 Satt373 11 178.20 178.58 Satt373 12 185.85 186.11 Satt373 13 191.97 192.37 Satt373 14 194.93 195.33 Satt373 15 198.10 198.40 Satt373 16 215.96 216.71 Satt373 17 218.80 219.66 Satt373 18 207.11 207.31 Satt378 1 138.70 139.45 Satt378 2 151.75 152.78 Satt378 3 145.61 145.81 Satt378 4 148.82 149.22 Satt378 5 159.86 160.26 Satt380 1 147.94 148.82 Satt380 2 149.22 149.82 Satt380 3 151.31 152.15 Satt380 4 152.35 152.78 Satt383 1 341.04 341.89 Satt383 2 345.72 346.86 Satt383 3 348.45 349.60 Satt383 4 351.32 352.42 Satt383 5 340.29 340.49 Satt383 6 344.22 344.42 Satt384 1 125.06 125.76 Satt384 2 153.68 154.45 Satt384 3 156.80 157.34 Satt385 1 100.37 101.41 Satt385 2 115.70 116.30 Satt385 3 128.08 128.60 Satt385 4 140.32 141.60 Satt385 5 143.45 144.53

Satt385 6 149.91 151.11 Satt385 7 146.97 148.06 Satt385 8 156.29 157.34 Satt385 9 160.87 161.37 Satt385 10 163.84 164.34 Satt385 11 173.06 174.29 Satt385 12 153.18 153.38 Satt387 1 171.12 171.59 Satt387 2 177.90 178.37 Satt387 3 200.35 201.14 Satt387 4 204.90 206.40 Satt387 5 212.97 213.97 Satt387 6 216.16 216.36 Satt389 1 145.91 146.49 Satt389 2 148.87 149.67 Satt389 3 153.28 154.21 Satt389 4 173.49 174.62 Satt389 5 176.43 177.45 Satt389 6 179.45 180.94 Satt389 7 147.96 148.26 Satt389 8 156.44 156.84 Satt389 9 182.45 183.15 Satt389 10 140.52 140.82 Satt389 11 168.22 168.42 Satt390 1 358.94 359.73 Satt390 2 361.62 362.77 Satt390 3 356.49 356.92 Satt390 4 364.73 365.44 Satt390 5 350.67 350.87 Satt391 1 168.69 169.65 Satt391 2 183.67 184.68 Satt391 3 181.12 181.29 Satt391 4 187.28 187.48 Satt393 1 325.13 326.20 Satt393 2 328.15 329.16 Satt393 3 322.09 322.50 Satt393 4 331.47 331.67 Satt398 1 151.61 152.78 Satt398 2 154.70 155.84 Satt398 3 157.71 158.86 Satt398 4 166.76 167.92 Satt398 5 169.85 171.12 Satt398 6 160.79 161.87 Satt398 7 163.89 164.82 Satt398 8 176.43 176.93 Satt398 9 179.85 180.32 Satt398 10 182.25 183.72 Satt398 11 148.62 148.82 Satt399 1 312.51 313.76 Satt399 2 325.00 326.12 Satt399 3 328.05 329.37 Satt399 4 331.31 332.12 Satt406 1 161.57 162.57 Satt406 2 239.21 240.38 Satt406 3 242.25 243.33 Satt406 4 245.41 246.20 Satt406 5 158.73 159.46 Satt406 6 233.42 233.82 Satt406 7 230.34 230.44 Satt406 8 215.47 215.57 Satt406 9 236.28 237.26 Satt406 10 227.26 227.46 Satt409 1 166.29 166.76 Satt409 2 169.19 170.15 Satt409 3 174.99 176.16 Satt409 4 184.18 185.20 Satt409 5 187.08 188.35 Satt409 6 193.68 194.44 Satt409 7 199.69 200.39 Satt409 8 196.72 196.90 Satt409 9 157.24 157.54 Satt409 10 163.56 163.66 Satt409 11 202.79 202.90 Satt409 12 190.51 191.28 Satt409 13 172.29 172.39 Satt411 1 97.95 99.06 Satt411 2 100.93 102.21 Satt411 3 93.77 94.17 Satt412 1 248.70 249.57 Satt412 2 254.76 255.78 Satt412 3 257.79 258.83 Satt412 4 260.81 261.88 Satt412 5 263.87 264.94 Satt412 6 251.91 252.73 Satt412 7 267.23 268.00 Satt413 1 333.87 334.84 Satt413 2 356.86 357.96 Satt413 3 359.66 360.72 Satt413 4 369.64 370.75 Satt413 5 342.16 342.36 Satt413 6 342.96 342.99 Satt413 7 366.61 366.81 Satt413 8 368.63 369.49 Satt414 1 277.87 279.18 Satt414 2 317.75 319.16 Satt414 3 321.22 322.30 Satt414 4 324.15 325.32 Satt414 5 327.35 328.36 Satt414 7 336.62 337.31 Satt414 8 302.69 303.40 Satt414 9 315.21 316.23 Satt414 10 339.70 340.19 Satt414 11 342.66 342.86 Satt414 12 330.78 331.28 Satt415 1 290.25 291.40 Satt415 2 297.19 298.60 Satt415 3 300.33 301.87 Satt415 4 303.75 304.96 Satt415 5 310.07 310.97 Satt415 6 323.10 323.50 Satt415 7 292.05 292.35 Satt415 8 307.61 307.96 Satt415 9 288.66 289.45 Satt416 1 241.96 242.16 Satt416 2 253.32 254.26 Satt416 3 256.56 257.91 Satt416 4 262.64 263.42 Satt416 5 265.86 266.48 Satt416 6 280.82 282.30 Satt416 7 244.34 244.77 Satt416 8 259.66 260.05 Satt417 1 299.06 300.33 Satt417 2 318.26 319.27 Satt417 3 321.44 322.30 Satt417 4 339.40 341.13 Satt417 5 342.44 343.92 Satt417 6 336.96 337.51 Satt418 1 207.40 208.42 Satt418 2 210.36 211.45 Satt418 3 213.40 214.47 Satt418 4 216.35 217.45 Satt418 5 219.41 219.88 Satt418 6 189.53 190.00 Satt418 7 192.47 193.45 Satt418 8 198.60 199.39 Satt418 9 204.50 204.85 Satt420 1 249.67 250.71 Satt420 2 260.72 261.97 Satt420 3 266.98 268.00 Satt420 4 274.62 275.12 Satt420 5 252.88 253.74 Satt420 6 256.08 256.29 Satt420 7 264.22 264.44 Satt421 1 135.14 136.43 Satt421 2 144.83 146.49 Satt421 3 148.55 149.22 Satt422 1 311.60 312.77 Satt422 2 321.29 321.79 Satt422 3 330.38 331.74 Satt422 4 333.35 334.34 Satt422 5 315.31 315.61 Satt422 6 318.36 319.30 Satt422 7 336.92 337.12 Satt422 8 327.85 328.05 Satt423 1 241.76 242.75 Satt423 2 262.90 263.92 Satt423 3 266.06 266.98 Satt423 4 340.05 340.69 Satt423 6 321.79 321.89 Satt423 7 248.60 248.80 Satt426 1 198.39 199.59 Satt426 2 200.39 200.89 Satt426 3 202.39 203.40 Satt426 4 203.90 204.40 Satt426 5 205.34 206.40 Satt426 6 217.55 218.03 Satt426 7 192.46 192.66 Satt426 8 223.59 223.76 Satt426 9 196.90 197.00 Satt429 1 263.42 264.22 Satt429 2 266.48 267.50 Satt429 3 269.53 270.65 Satt429 4 272.54 273.65 Satt429 5 245.21 246.11 Satt429 6 248.20 248.85 Satt429 7 254.46 254.76 Satt429 8 275.83 276.43 Satt429 9 257.31 257.71 Satt430 1 241.76 242.75 Satt430 2 244.72 245.41 Satt430 3 248.10 248.70 Satt430 4 254.26 254.46 Satt430 5 257.31 257.51 Satt430 6 239.21 239.30 Satt431 1 305.46 306.38 Satt431 2 318.20 318.96 Satt431 3 321.29 322.30 Satt431 4 324.31 324.81 Satt431 5 342.51 343.29 Satt431 6 348.11 349.07 Satt431 7 315.41 315.51 Satt431 8 331.37 331.57 Satt431 9 328.05 328.25 Satt431 10 340.15 340.29 Satt431 11 345.50 345.88 Satt431 12 351.44 351.54 Satt432 1 255.78 256.29 Satt432 2 258.53 259.50 Satt432 3 261.72 262.40 Satt432 4 264.89 265.46 Satt433 1 125.56 126.50 Satt433 2 134.74 135.78 Satt433 3 144.33 145.41 Satt433 4 153.80 154.98 Satt433 5 166.14 167.20 Satt433 6 156.64 156.94 Satt433 7 138.19 138.49 Satt433 8 159.55 159.86 Satt436 1 187.58 188.75 Satt436 2 208.93 209.94 Satt436 3 244.72 245.76 Satt436 4 226.96 227.26 Satt436 5 247.70 248.85 Satt436 6 250.71 251.92 Satt436 7 203.30 203.60 Satt436 8 254.11 254.76 Satt440 1 286.23 287.23 Satt440 2 307.74 308.88 Satt440 3 320.28 320.98 Satt440 4 338.74 339.58 Satt440 5 287.33 288.04 Satt440 6 323.70 324.36 Satt440 7 335.80 336.32 Satt440 8 317.45 317.65 Satt441 1 161.80 162.77 Satt441 2 164.82 165.79 Satt441 3 173.68 174.69 Satt441 4 176.69 177.70 Satt441 5 179.78 180.62 Satt441 6 191.90 192.86 Satt441 7 207.02 207.92 Satt441 8 171.07 171.59 Satt441 10 168.42 168.52 Satt441 11 136.72 137.43 Satt441 12 152.88 153.48 Satt441 13 158.95 159.75 Satt441 14 155.84 156.44 Satt441 15 195.03 195.70 Satt441 16 185.85 186.39 Satt441 17 189.52 189.72 Satt442 1 240.28 240.78 Satt442 2 246.20 247.30 Satt442 3 249.20 250.21 Satt442 4 252.23 253.24 Satt442 5 261.68 262.40 Satt442 6 264.44 265.46 Satt442 7 258.63 259.03 Satt442 8 243.66 244.13 Satt442 9 267.80 268.20 Satt442 10 237.63 238.03 Satt442 11 255.72 256.29

Satt442 12 283.01 283.31 Satt442 13 270.75 271.00 Satt444 1 134.84 136.28 Satt444 2 137.94 138.95 Satt445 1 166.18 166.96 Satt445 2 169.02 169.85 Satt445 3 184.28 185.15 Satt445 4 193.35 194.54 Satt445 5 196.52 197.40 Satt445 6 215.17 215.47 Satt445 7 163.11 163.76 Satt445 8 190.20 190.80 Satt445 9 178.78 179.08 Satt445 10 187.38 187.83 Satt445 11 217.45 217.90 Satt448 1 340.69 341.63 Satt448 2 347.47 348.19 Satt448 3 350.42 350.92 Satt448 4 355.86 356.92 Satt448 5 361.62 362.12 Satt448 6 358.66 359.34 Satt448 7 364.68 365.08 Satt448 8 343.59 343.92 Satt448 9 332.07 332.27 Satt448 10 324.81 325.01 Satt451 1 325.32 326.49 Satt451 2 351.84 352.37 Satt451 3 354.42 355.25 Satt451 4 357.52 357.72 Satt451 5 319.67 319.92 Satt452 1 256.74 257.81 Satt452 2 259.68 260.86 Satt452 3 263.42 263.92 Satt452 4 265.81 266.98 Satt452 5 274.98 275.83 Satt452 6 296.79 296.99 Satt452 7 254.14 254.36 Satt452 8 302.57 303.40 Satt452 9 272.46 272.78 Satt452 10 309.45 309.55 Satt454 1 158.70 159.60 Satt454 2 170.40 171.59 Satt454 3 173.53 174.49 Satt454 4 176.63 177.50 Satt454 5 161.87 162.37 Satt454 6 182.95 183.15 Satt455 1 273.08 274.10 Satt455 2 276.03 277.15 Satt455 3 279.31 280.19 Satt457 1 356.79 357.42 Satt457 2 368.33 369.29 Satt457 3 324.81 325.11 Satt457 4 336.67 337.12 Satt457 5 354.12 354.32 Satt457 6 365.44 366.09 Satt457 7 371.42 371.82 Satt460 1 113.80 114.50 Satt460 2 116.66 117.63 Satt460 3 135.24 136.08 Satt460 4 144.83 145.61 Satt460 5 160.36 161.17 Satt460 6 163.46 164.24 Satt460 7 129.40 129.61 Satt461 1 128.60 129.61 Satt461 2 131.65 132.67 Satt461 3 138.39 138.95 Satt461 4 144.83 145.41 Satt461 5 154.30 154.82 Satt461 6 122.95 124.05 Satt461 7 153.28 153.80 Satt461 8 134.94 135.24 Satt464 1 144.77 146.31 Satt464 2 164.65 165.79 Satt464 3 174.13 175.55 Satt464 4 168.02 168.42 Satt464 5 177.90 178.10 Satt466 1 165.27 166.29 Satt466 2 168.32 169.19 Satt466 3 177.80 178.77 Satt467 1 274.79 275.52 Satt467 2 294.84 295.98 Satt469 1 245.81 246.90 Satt469 2 276.65 277.20 Satt469 3 279.69 280.24 Satt469 4 225.63 225.89 Satt469 5 249.50 249.80 Satt470 1 263.62 264.94 Satt470 2 266.48 268.00 Satt471 1 233.92 234.60 Satt471 2 245.71 246.70 Satt471 3 248.70 249.70 Satt473 1 307.51 308.53 Satt473 2 310.57 311.60 Satt473 3 313.86 314.69 Satt473 4 317.25 317.75 Satt473 5 295.27 295.78 Satt473 6 298.30 298.81 Satt473 7 301.35 302.37 Satt473 8 304.43 305.46 Satt473 9 292.20 292.35 Satt475 1 150.47 151.46 Satt475 2 159.86 160.87 Satt475 3 171.92 173.06 Satt475 4 175.46 175.66 Satt475 5 178.10 178.30 Satt476 1 343.49 344.02 Satt476 2 346.43 347.21 Satt476 3 354.62 355.55 Satt476 4 357.52 358.36 Satt476 5 365.94 366.91 Satt476 6 349.17 349.37 Satt476 7 351.94 352.27 Satt476 8 360.53 360.67 Satt476 9 363.37 363.72 Satt476 10 325.62 325.92 Satt477 1 141.60 142.67 Satt477 2 157.34 158.35 Satt477 3 163.62 164.44 Satt477 4 154.71 155.42 Satt477 5 161.07 161.27 Satt478 1 194.36 195.23 Satt478 2 227.16 227.82 Satt478 3 232.95 234.12 Satt478 4 236.28 236.86 Satt478 5 239.30 240.15 Satt478 6 242.25 243.03 Satt478 7 254.26 255.11 Satt478 8 257.31 258.06 Satt478 9 224.41 224.73 Satt478 10 230.40 230.70 Satt478 11 251.42 251.82 Satt478 12 248.40 248.75 Satt478 13 221.56 221.66 Satt478 14 221.26 221.46 Satt479 1 114.30 115.40 Satt479 2 117.63 118.50 Satt479 3 142.52 143.25 Satt479 4 145.41 146.49 Satt479 5 151.75 152.83 Satt479 6 111.76 112.01 Satt480 1 137.81 138.95 Satt480 2 140.99 142.17 Satt480 3 144.33 145.41 Satt487 1 114.30 114.90 Satt487 2 117.16 118.13 Satt487 3 120.28 121.07 Satt487 4 123.05 124.20 Satt487 5 126.31 127.07 Satt487 6 111.36 111.91 Satt487 7 132.67 132.87 Satt487 8 135.78 135.98 Satt487 9 129.61 129.91 Satt488 1 295.57 295.78 Satt488 2 311.35 312.33 Satt488 3 314.61 315.41 Satt488 4 323.85 324.71 Satt488 5 327.29 327.75 Satt491 1 195.86 196.52 Satt491 2 201.78 202.49 Satt491 3 207.41 208.42 Satt491 4 216.95 217.35 Satt491 5 219.98 220.28 Satt492 1 235.72 237.13 Satt492 2 238.81 239.97 Satt492 3 227.46 227.62 Satt493 1 266.41 267.50 Satt493 2 269.83 270.55 Satt493 3 281.93 282.71 Satt493 4 279.23 279.38 Satt495 1 231.00 231.97 Satt495 2 243.11 244.22 Satt495 3 237.33 237.83 Satt497 1 268.82 269.53 Satt497 2 271.96 272.58 Satt497 3 274.62 276.23 Satt497 4 277.67 279.03 Satt497 5 296.18 297.49 Satt497 6 299.31 300.43 Satt497 7 281.10 281.90 Satt497 8 265.86 266.06 Satt497 9 262.80 263.20 Satt503 1 226.19 227.00 Satt503 2 228.90 230.09 Satt503 3 231.92 233.15 Satt503 4 221.83 222.55 Satt503 5 211.15 211.65 Satt503 6 224.93 225.23 Satt503 7 234.95 235.59 Satt503 8 223.00 223.10 Satt506 1 280.19 281.35 Satt506 2 283.21 284.01 Satt506 3 292.26 293.61 Satt506 4 289.75 290.15 Satt507 1 230.60 231.47 Satt507 2 233.42 234.40 Satt507 3 236.36 237.43 Satt507 4 227.62 228.02 Satt507 5 239.70 239.90 Satt508 1 333.06 334.15 Satt508 2 336.15 337.31 Satt508 3 339.25 339.65 Satt509 1 192.47 193.55 Satt509 2 195.43 196.52 Satt509 3 198.40 199.39 Satt509 4 201.39 202.59 Satt509 5 204.78 205.40 Satt509 6 236.86 238.41 Satt509 7 249.20 250.41 Satt509 8 240.68 241.18 Satt509 9 243.79 244.22 Satt509 10 184.18 184.48 Satt509 11 252.83 253.13 Satt510 1 109.05 109.55 Satt510 2 127.07 127.58 Satt510 3 136.08 137.33 Satt510 4 139.35 140.52 Satt510 5 96.44 97.45 Satt510 6 121.07 122.06 Satt510 7 111.91 112.86 Satt510 8 130.11 130.31 Satt511 1 255.83 256.79 Satt511 2 262.02 262.90 Satt511 3 265.03 266.01 Satt511 4 268.06 269.07 Satt511 5 277.87 278.07 Satt511 6 259.23 259.55 Satt512 1 316.16 317.25 Satt512 2 319.37 320.28 Satt512 3 325.53 326.44 Satt512 4 328.71 329.57 Satt512 5 331.77 332.86 Satt512 6 310.07 310.62 Satt512 7 313.03 313.68 Satt513 1 117.63 118.13 Satt513 2 130.11 130.63 Satt513 3 142.17 143.25 Satt513 4 173.06 173.83 Satt513 5 181.79 182.75 Satt513 6 185.05 185.65 Satt513 7 170.15 170.62 Satt513 8 164.34 164.44 Satt513 9 167.26 167.63 Satt513 10 133.07 133.37 Satt513 11 139.14 139.65 Satt513 12 148.77 148.92 Satt513 13 153.38 153.58 Satt513 14 145.81 146.11 Satt514 1 314.34 315.21 Satt514 2 316.63 317.25 Satt514 3 325.76 326.34 Satt514 4 351.18 351.94

Satt514 5 328.96 329.26 Satt514 6 329.77 330.38 Satt514 7 331.97 332.36 Satt514 8 337.12 337.71 Satt514 9 340.15 340.39 Satt514 10 328.25 328.56 Satt514 11 345.78 346.18 Satt514 12 359.93 360.13 Satt514 13 362.87 363.17 Satt514 14 354.22 354.62 Satt514 15 334.25 334.34 Satt515 1 341.13 342.06 Satt515 2 352.77 353.69 Satt515 3 355.05 356.44 Satt517 1 159.30 160.36 Satt517 2 162.12 163.56 Satt517 3 165.13 166.49 Satt517 4 173.15 174.50 Satt517 5 176.21 177.23 Satt517 6 179.45 180.15 Satt517 7 149.89 150.91 Satt517 8 170.05 171.02 Satt519 1 354.60 355.55 Satt519 2 357.42 358.36 Satt519 3 360.33 361.17 Satt519 4 363.27 363.47 Satt519 5 372.02 372.18 Satt522 1 231.47 232.34 Satt522 2 240.78 241.26 Satt522 3 255.78 256.89 Satt522 4 258.83 259.90 Satt522 5 283.31 284.36 Satt522 6 237.53 238.13 Satt522 7 252.83 253.39 Satt522 8 280.29 280.70 Satt523 1 171.58 172.39 Satt523 2 174.43 175.34 Satt523 3 189.52 190.40 Satt523 4 192.76 193.45 Satt523 5 184.02 184.18 Satt523 6 199.04 199.39 Satt524 1 168.22 168.94 Satt524 2 171.12 172.29 Satt524 3 177.40 177.60 Satt524 4 174.59 174.89 Satt526 1 322.80 324.22 Satt526 2 332.02 333.44 Satt529 1 214.47 215.47 Satt529 2 220.38 221.35 Satt529 3 217.85 218.08 Satt529 4 229.67 230.24 Satt529 5 223.96 224.06 Satt532 1 170.15 171.37 Satt532 2 172.86 174.48 Satt532 3 179.35 180.37 Satt532 4 182.50 183.32 Satt532 5 154.40 154.82 Satt532 6 175.31 176.55 Satt532 7 176.58 177.40 Satt532 8 167.48 168.17 Satt533 1 169.19 170.15 Satt533 2 174.99 175.96 Satt533 3 193.94 194.44 Satt533 4 196.72 196.90 Satt533 5 172.23 172.96 Satt533 6 178.37 178.57 Satt533 7 193.15 193.55 Satt534 1 165.79 166.90 Satt534 2 172.01 173.06 Satt534 3 177.90 178.87 Satt534 4 180.82 181.84 Satt534 5 183.72 185.15 Satt534 6 187.08 188.55 Satt534 7 190.00 191.28 Satt534 8 192.95 194.44 Satt534 9 195.92 197.05 Satt534 10 163.36 163.84 Satt534 11 160.36 160.76 Satt534 12 169.18 169.85 Satt534 13 157.34 157.74 Satt534 14 175.04 175.96 Satt534 15 199.89 200.19 Satt534 16 150.71 151.11 Satt536 1 220.76 221.83 Satt536 2 223.76 224.26 Satt536 3 226.66 227.72 Satt536 4 229.38 230.70 Satt536 5 197.20 197.50 Satt536 6 232.95 234.22 Satt536 7 236.18 236.61 Satt537 1 292.58 293.76 Satt537 2 295.78 296.79 Satt537 3 311.28 312.63 Satt537 4 317.75 318.36 Satt537 5 320.67 321.79 Satt537 6 323.80 324.81 Satt537 7 301.35 302.62 Satt537 8 308.03 309.10 Satt537 9 280.43 281.20 Satt537 10 289.75 290.25 Satt537 11 299.31 299.83 Satt537 12 305.46 305.98 Satt537 13 314.69 315.21 Satt537 14 333.35 333.85 Satt537 15 283.61 283.91 Satt540 1 175.14 176.06 Satt540 2 181.17 182.25 Satt540 3 190.28 191.48 Satt540 4 192.71 194.19 Satt540 5 199.39 200.39 Satt540 6 210.59 211.96 Satt540 7 213.37 213.85 Satt540 8 169.65 170.15 Satt540 9 184.68 185.15 Satt540 10 187.58 188.05 Satt540 12 195.73 196.12 Satt540 13 196.56 197.20 Satt540 14 204.70 204.90 Satt543 1 171.12 172.39 Satt543 2 174.39 175.09 Satt543 3 175.29 176.26 Satt543 4 195.43 196.52 Satt543 5 198.83 199.49 Satt543 6 207.41 208.42 Satt543 7 210.95 211.45 Satt543 8 213.65 214.47 Satt543 9 210.34 210.54 Satt543 10 216.56 217.05 Satt543 11 178.15 178.78 Satt544 1 116.66 117.63 Satt544 2 147.56 149.12 Satt544 3 154.30 155.84 Satt544 4 160.56 161.37 Satt544 5 163.56 164.34 Satt544 6 166.54 167.72 Satt544 7 169.59 170.62 Satt544 8 132.15 132.45 Satt544 9 151.41 151.61 Satt544 10 157.54 157.79 Satt544 11 172.44 173.53 Satt545 1 242.25 242.85 Satt545 2 254.11 254.66 Satt545 3 260.29 260.86 Satt545 4 275.32 276.23 Satt545 5 278.35 279.48 Satt545 6 281.59 282.30 Satt545 7 284.46 285.32 Satt545 8 290.55 292.10 Satt545 9 293.64 294.56 Satt545 10 266.36 266.78 Satt545 11 272.58 272.98 Satt545 12 287.84 288.04 Satt545 13 296.79 297.29 Satt545 14 269.53 269.98 Satt546 1 332.22 333.26 Satt546 2 341.33 342.06 Satt546 3 344.12 344.85 Satt546 4 355.29 356.49 Satt546 5 358.46 358.66 Satt548 1 352.27 352.77 Satt548 2 359.73 361.17 Satt548 3 362.57 364.12 Satt548 4 365.63 366.41 Satt548 5 348.57 348.97 Satt548 6 351.34 351.54 Satt548 7 368.83 368.93 Satt549 1 225.08 225.33 Satt549 2 233.92 234.80 Satt549 3 240.10 240.38 Satt549 4 243.05 243.23 Satt549 5 245.94 246.80 Satt549 6 249.00 250.00 Satt549 7 255.38 255.88 Satt550 1 223.78 224.73 Satt550 2 226.66 227.46 Satt550 3 241.76 242.85 Satt550 4 244.72 245.71 Satt550 5 229.84 230.24 Satt550 6 220.91 221.36 Satt550 7 232.80 233.35 Satt550 8 238.96 239.16 Satt551 1 230.50 231.57 Satt551 2 236.85 237.63 Satt551 3 242.75 243.73 Satt552 1 160.66 161.67 Satt552 2 175.66 176.68 Satt552 3 181.73 182.80 Satt552 4 184.98 185.75 Satt552 5 169.80 170.62 Satt555 1 249.45 250.30 Satt555 2 271.56 272.75 Satt555 3 274.87 275.78 Satt555 4 277.96 278.68 Satt556 1 135.95 136.83 Satt556 2 148.62 149.94 Satt556 3 151.96 152.78 Satt556 4 184.68 186.12 Satt556 5 197.30 197.99 Satt556 6 155.32 155.84 Satt556 7 164.34 164.82 Satt556 8 168.22 168.69 Satt556 9 176.93 177.90 Satt556 10 188.45 188.65 Satt557 1 201.89 202.90 Satt557 2 204.90 205.90 Satt557 3 211.20 212.01 Satt557 4 214.17 214.97 Satt557 5 220.29 221.36 Satt557 6 208.42 208.93 Satt557 7 193.45 193.75 Satt558 1 220.38 221.46 Satt558 2 229.54 230.55 Satt558 3 235.38 236.66 Satt558 4 238.68 239.70 Satt558 6 233.05 233.42 Satt558 7 241.86 242.45 Satt558 8 245.21 245.41 Satt560 1 231.06 231.97 Satt560 2 237.11 238.91 Satt560 3 243.15 244.52 Satt560 4 246.20 247.40 Satt560 5 276.80 277.67 Satt560 6 286.02 286.83 Satt560 7 273.70 274.30 Satt560 8 271.25 271.56 Satt560 9 283.06 283.41 Satt560 10 250.10 250.21 Satt560 11 253.13 253.24 Satt563 1 166.45 167.82 Satt563 2 169.65 170.82 Satt563 3 236.85 237.83 Satt563 4 173.53 174.49 Satt563 5 181.49 182.95 Satt563 6 212.36 213.47 Satt563 8 160.42 160.99 Satt563 9 164.34 164.54 Satt563 10 206.30 207.41 Satt563 11 185.15 185.55 Satt563 12 209.63 209.83 Satt565 1 299.47 300.33 Satt565 2 302.62 304.63 Satt565 3 327.31 328.46 Satt565 4 351.34 351.84 Satt565 5 330.48 331.06 Satt566 1 356.49 357.42 Satt566 2 359.44 360.23 Satt566 3 362.12 363.07 Satt566 4 365.18 365.94 Satt566 5 374.11 375.06 Satt566 6 376.96 377.90 Satt566 7 367.97 368.33

Satt566 8 379.97 380.17 Satt566 9 385.90 386.30 Satt567 1 97.45 97.95 Satt567 2 112.41 113.36 Satt567 3 115.25 116.20 Satt567 4 118.56 119.10 Satt567 5 110.01 110.51 Satt567 6 98.05 98.15 Satt568 1 345.38 346.08 Satt568 2 350.62 351.84 Satt568 3 357.02 357.22 Satt568 4 354.12 354.42 Satt569 1 103.33 104.23 Satt569 2 115.60 116.30 Satt569 3 121.47 122.55 Satt569 4 124.56 125.31 Satt569 5 127.58 128.38 Satt569 6 130.63 131.38 Satt569 7 133.70 134.10 Satt569 8 106.59 106.99 Satt570 1 108.50 109.05 Satt570 2 111.41 112.41 Satt570 3 114.48 115.25 Satt570 4 126.57 127.58 Satt570 5 120.72 120.97 Satt570 6 130.01 130.21 Satt570 7 132.94 133.17 Satt572 1 172.56 174.08 Satt572 2 175.86 176.53 Satt572 3 178.87 179.50 Satt572 4 169.89 170.45 Satt573 1 167.36 167.56 Satt573 2 163.84 164.82 Satt573 3 175.96 176.53 Satt576 1 261.38 261.88 Satt576 2 288.75 290.25 Satt576 3 342.10 342.99 Satt576 4 350.48 351.84 Satt576 5 361.83 363.07 Satt576 6 365.11 365.94 Satt576 7 353.64 354.12 Satt576 8 356.69 356.89 Satt576 9 359.09 359.59 Satt577 1 312.82 313.96 Satt577 2 316.01 317.25 Satt578 1 178.37 179.35 Satt578 2 181.29 182.25 Satt578 3 199.89 200.39 Satt578 4 202.39 203.00 Satt578 5 199.49 199.79 Satt578 6 184.78 184.98 Satt581 1 138.39 139.45 Satt581 2 148.06 149.22 Satt581 3 151.21 152.43 Satt581 4 161.07 161.27 Satt582 1 333.83 334.34 Satt582 2 336.72 337.31 Satt582 3 339.75 340.19 Satt582 4 318.76 319.16 Satt583 1 122.06 123.05 Satt583 2 146.99 147.86 Satt583 3 150.17 151.21 Satt583 4 180.82 181.64 Satt583 5 125.56 125.76 Satt583 6 131.58 131.95 Satt583 7 137.89 138.09 Satt583 8 141.10 141.30 Satt583 9 144.15 144.60 Satt583 10 113.46 113.66 Satt583 11 116.50 116.66 Satt583 12 153.80 154.00 Satt583 13 156.84 157.04 Satt583 14 159.96 160.16 Satt583 15 168.99 169.19 Satt583 16 198.89 199.19 Satt583 17 202.09 202.39 Satt583 18 222.89 223.39 Satt584 1 171.59 172.56 Satt584 2 174.49 175.46 Satt584 3 180.77 181.32 Satt584 4 195.43 196.42 Satt584 5 183.72 184.68 Satt584 6 186.91 188.85 Satt584 7 198.89 199.89 Satt586 1 318.76 319.77 Satt586 2 337.12 338.01 Satt586 3 342.99 343.79 Satt586 4 348.57 349.50 Satt586 5 354.14 355.05 Satt586 6 331.18 331.77 Satt586 7 334.15 334.54 Satt586 8 340.05 340.84 Satt586 9 351.34 351.94 Satt587 1 168.02 169.19 Satt587 2 170.97 172.20 Satt587 3 173.93 175.05 Satt587 4 176.93 177.90 Satt587 5 129.10 129.61 Satt587 6 155.84 156.34 Satt590 1 317.18 318.26 Satt590 2 323.30 324.81 Satt590 3 332.86 333.55 Satt590 4 335.78 336.87 Satt590 6 339.25 339.75 Satt590 7 266.88 268.52 Satt590 8 272.88 274.62 Satt590 9 264.22 264.44 Satt590 12 314.28 315.21 Satt590 13 304.83 305.16 Satt590 14 320.48 321.06 Satt590 15 300.73 301.25 Satt590 16 311.10 312.00 Satt590 17 326.64 327.60 Satt590 18 329.87 330.88 Satt591 1 137.43 138.44 Satt591 2 140.52 141.60 Satt591 3 150.27 151.59 Satt591 4 144.63 144.83 Satt591 5 119.20 119.50 Satt592 1 236.85 237.43 Satt592 2 242.75 243.53 Satt592 3 245.71 246.85 Satt592 4 254.76 255.87 Satt594 1 122.50 123.25 Satt594 2 134.74 135.44 Satt594 3 141.10 141.60 Satt594 4 144.33 145.61 Satt594 5 147.56 148.82 Satt594 6 166.22 167.36 Satt594 7 172.56 173.63 Satt594 8 157.04 157.64 Satt594 9 160.06 160.46 Satt594 10 178.20 179.13 Satt594 11 138.09 138.29 Satt594 12 169.19 169.59 Satt595 1 340.05 341.13 Satt595 2 342.99 344.85 Satt595 4 345.98 346.38 Satt596 1 257.73 258.83 Satt596 2 260.72 261.88 Satt596 3 266.68 267.70 Satt596 4 272.86 273.90 Satt596 5 275.88 277.15 Satt596 6 281.80 282.91 Satt596 7 264.17 264.64 Satt596 8 270.10 270.65 Satt596 9 279.43 279.58 Satt596 10 251.92 252.12 Satt597 1 144.68 145.51 Satt597 2 147.86 148.82 Satt597 3 160.26 161.37 Satt597 4 157.34 157.90 Satt598 1 163.36 164.37 Satt598 2 175.46 176.43 Satt601 1 344.86 345.93 Satt601 2 347.84 348.57 Satt601 3 342.36 342.66 Satt601 4 351.02 351.22 Satt601 5 356.39 356.59 Satt601 6 336.72 336.92 Satt602 1 336.21 336.82 Satt602 2 339.14 341.14 Satt602 4 342.86 343.92 Sct_010 1 107.29 108.10 Sct_010 2 99.45 99.95 Sct_010 3 105.44 105.64 Sct_026 1 328.36 329.37 Sct_026 2 330.38 331.37 Sct_026 3 326.64 326.84 Sct_026 4 333.80 334.25 Sct_026 5 317.50 317.65 Sct_028 1 236.07 237.33 Sct_028 2 244.12 245.21 Sct_028 3 248.10 249.20 Sct_028 4 242.10 243.23 Sct_034 1 126.67 127.58 Sct_034 2 128.83 129.61 Sct_034 3 130.63 131.65 Sct_046 1 260.66 262.28 Sct_046 2 267.69 268.52 Sct_046 3 275.88 276.65 Sct_046 4 277.89 278.68 Sct_046 5 284.15 285.73 Sct_046 6 286.23 287.83 Sct_046 7 288.24 288.75 Sct_046 8 292.89 293.76 Sct_046 9 298.60 299.83 Sct_046 10 290.05 290.75 Sct_046 11 270.03 270.55 Sct_046 12 274.10 274.62 Sct_046 13 282.71 283.71 Sct_065 1 163.26 164.40 Sct_065 2 165.27 166.40 Sct_065 3 171.12 172.18 Sct_137 1 269.32 270.03 Sct_137 2 273.08 274.10 Sct_147 1 130.11 131.03 Sct_147 2 136.28 136.93 Sct_186 1 97.45 97.95 Sct_186 2 105.24 105.74 Sct_186 3 111.36 111.91 Sct_186 4 113.36 113.80 Sct_186 5 115.35 115.70 Sct_186 6 117.36 117.63 Sct_187 1 313.34 314.19 Sct_187 2 311.40 311.90 Sct_187 3 315.21 317.35 Sct_188 1 242.25 243.23 Sct_188 2 252.23 253.24 Sct_188 3 254.76 254.96 Sctt008 1 159.36 159.86 Sctt008 2 162.36 163.36 Sctt008 3 165.42 165.62 Sctt008 4 147.56 147.76 Sctt009 1 213.93 214.97 Sctt009 2 219.71 220.86 Sctt012 1 343.92 344.72 Sctt012 2 351.84 353.02 Sctt012 3 355.05 355.55

TABLE-US-00017 APPENDIX II SSR Markers: Table of Primers 9 pages Marker SEQ ID SEQ ID Name Left Primer Sequence NO Right Primer Sequence NO Pigtail Repeat Sac1006 CAATCAGGTTAGTGGTCCTACC 1 CAAAAGGTTTTCAGTGGTGG 285 GTTTCTT 2 Sac1677 AAGTTCACAGCACCTGGACCAT 2 CCAATCCCTACCCTGATTGCAC 286 GTTTCTT 2 Sat_084 GAAACAAACACCCCCAAGGTGA 3 GGAAGTGGATTTGGAGTTGGGA 287 GTTTCTT 2 Sat_090 CCAATCGTGTCTTATCCTCGGG 4 AACCCATAACCTGCTCGTCTCA 288 GTTTCTT 2 Sat_104 TTCCAGACAGAACCCAAGTAGCC 5 AGGCGGGTTTGGAGCTGTTTAC 289 GTTTCTT 2 Sat_110 AACATTTTTCATCGCTTTTCTTAG 6 TCTTCTCAGGAACTTGAATTACTCA 290 GTTTCTT 2- Sat_117 AAAGCATTTTTGGCAGTTTCTTGT 7 GGAATGTCCCAAGTGTCAGCAA 291 GTTTCTT 2 Satt020 TGGACAGAATGGAGAAAGAAATGTG 8 TGAAAATAAGTGGAAAGAAAAAGGAAAA 292 GTTTC- TT 3 Satt040 CCAAGCCAAACAAAGAATCACA 9 GTCCCCGTTCCTCAAACACCTT 293 GTTTCTT 3 Satt042 GCTTGCTATGATTGATTGATTGATTGA 10 TGCACACTCACTTGGTCTTACACA 294 GTTTCT- T 3 Satt050 AGAACGGTGTTAAGATAGAATAGTT 11 CTGTTGGAAAATGATGCGTGGC 295 GTTTCTT 3 Satt066 GGGAAGCTTAATAATGAAAATGACAC 12 TTGATCACTTCTGTAACATTC 296 GTTTCTT 3 Satt092 AACCGATGCTTTTTTCGCCTTT 13 CTTTGTTGTTTGGTCAAGGCCC 297 GTTTCTT 3 Satt102 GAAGAAGGCTCAGCAACACCTTG 14 TGCCGAAATAAGTGAGAGCATAGAA 298 GTTTCTT 3- Satt108 CACCCAATCTTGCCTTTGAAACA 15 TGTTAGGTATGGGATTTAGGGTTTTGA 299 GTTTCTT- 3 Satt109 TAGACACTTTCAGGTTAAAATATAAC 16 TCCACTCACTGTATGTCTTCCCTTG 300 GTTTCT- T 3 Satt111 CAACTTGTCACTTACACATAGTTTAG 17 TTGAGTGCTCTTGGTGTTTTCCT 301 GTTTCTT - 3 Satt115 ATTTCGCTCGCAAACACAAGGT 18 CCAAACACCCCAGTATAAAAAATGGA 302 GTTTCTT 3- Sattl22 TCAAGAAATACAAGTGCAAGAAAGACC 19 GGATTTTGAGTTGCTCCAAGGC 303 GTTTCTT - 3 Satt127 AATTTTCGCTTGTGAACCCTGC 20 TGTATGATCCATCCTCTGAAACCG 304 GTTTCTT 3 Satt129 TTCAGTACAAGTCGGGTGAATAATAATA 21 TCACATGTTCGGGACTTAAGGTAT 305 GTTTC- TT 3 Satt130 TGGGACTCTCACACACGGAAAA 22 TGAATGGCTAAAAACGTGATTTGGA 306 GTTTCTT 3 Satt131 TGGGAGTCAATTTCCCATTATCA 23 GGACCTTCCCTTTCCCATGACT 307 GTTTCTT 3 Satt133 TGGATTTGAAACCACAAATAACAACAAC 24 AGCGATGGTTGAAGAAAGGGTC 308 GTTTCTT- 3 Satt138 AAAAGGGGGACATTTTTCCACG 25 AGAGAACGGGCGATTTATGGCT 309 GTTTCTT 3 Satt142 CATTAGGGACAACAACAGCGTTT 26 ATGTCGCCACTAGGCCAATCAG 310 GTTTCTT 3 Satt144 CGTCGCCATCACTATGAGAA 27 CCATCTTGAGCAGAGTTTGAAGTT 311 GTTTCTT 3 Satt146 AAGGGATCCCTCAACTGACTG 28 GTGGTGGTGGTGAAAACTATTAGAA 312 GTTTCTT 3 Satt147 CCATCCCTTCCTCCAAATAGAT 29 CTTCCACACCCTAGTTTAGTGACAA 313 GTTTCTT 3 Satt150 TGACGAAGCTTGAGGTTATTCG 30 TCAAGCTTATGCTCTATAGGCT 314 GTTTCTT 3 Satt151 GCCAAGAAGATAACAAGCTCGGC 31 GACCAAAATTCAAGGCAGTGACAA 315 GTTTCTT 3 Satt153 GGGTTATATCAGTTTTTCTTTTTGTT 32 CCATCCTCGTTAGCATCTAT 316 GTTTCTT 3 Satt155 AGATCCAACACCTGGCCTAAT 33 GCTGCACAATTCATTCCATTT 317 GTTTCTT 3 Satt156 AACAAAACTAGCCCATAGAAACATTGA 34 CCCAGGGACTTACTTTTTTCAGTTT 318 GTTTC- TT 3 Satt159 GAAATGCCCAGAAAAACCTAATAAC 35 TGAAGCAACAAAATAGAGGAATAGAG 319 GTTTCT- T 3 Satt165 GCCGTGAAGACAGTTGATCGTT 36 CATTACTAGGCGTGTGTTGTTTCAA 320 GTTTCTT 3 Satt166 CAGTTGATTTTTGTTTTTCGGCA 37 CACGCGCATCAGCTTTGTAGAG 321 GTTTCTT 3 Satt168 TTGTCCAAACTTGCAGGGAACA 38 TCTTTTCACCATTCTCCAACCTCA 322 GTTTCTT 3 Satt172 TGGATGAGTTCTATTGGGGTAGTCG 39 TCCTTTCTCCCATTTTTTTTGGG 323 GTTTCTT 3- Satt175 GACCTCGCTCTCTGTTTCTCAT 40 GGTGACCACCCCTATTCCTTAT 324 GTTTCTT 3 Satt176 CGCAATCCCAATTCACCTCTTC 41 AATTGTTAGGGCGCGAGAAACA 325 GTTTCTT 3 Satt181 GAACCCCGTTTCAACATTTTATGA 42 CTAGCCAAGGGAGAGAGGAGCA 326 GTTTCTT 3 Satt183 GGTCGTTAAGCCCACTTTGAGA 43 CCTCACACCAACCAGCACAAAA 327 GTTTCTT 3 Satt186 TGCAGCTTTCACTAATCGTCAGAA 44 CAATTTTATGATTTGCTTTTGAAGGGA 328 GTTTCT- T 3 Satt190 GGGAGTGTGAACTTACATTGTCT 45 GGGCCTTGAATTTTGTGCTAT 329 GTTTCTT 3 Satt191 GCGATCATGTCTCTGCCATCAG 46 CCTCTTGAAACCGTGAAACCGT 330 GTTTCTT 3 Satt193 GAAGGGATATGGAGAGTGAGAAATTAGA 47 TCTTTTTCTTCATTTTTGTTCGCA 331 GTTTC- TT 3 Satt195 AAAAATTGTGTAAACGAAAGATGGGA 48 AAACTGCTCTGAAGTGCGACACA 332 GTTTCTT - 3 Satt196 TGAGCCCAACCTCCACATCTTT 49 TGTGAATAAAAGAAATCCCCATTGA 333 GTTTCTT 3 Satt197 CACTGCTTTTTCCCCTCTCT 50 AAGATACCCCCAACATTATTTGTAA 334 GTTTCTT 3 Satt199 GCGGTAAATGGTGAAAATCATTTATGGTT 51 GCGTTTTCATACGGTGTTTTGCCTAT 335 GT- TTCTT 3 Satt202 GGAATGCATGAGTATTAACCTCTTAT 52 GGGCTAACGAACATGTAACTTATCAAC 336 GTTT- CTT 3 Satt203 TGTCTTCCCAATCCATCTAATCTAATCA 53 GCACTACAATATGTGCATGAATTTTTCT 337 G- TTTCTT 3 Satt204 CCAATTATGTTTCTATGCCATCTTGTT 54 TCTCCTTACTCACTCCATTGGCA 338 GTTTCTT- 3 Satt209 TGTGGATAAAAGCCATCTCTAACAAA 55 TCCATGTCACCAACCACAAAAA 339 GTTTCTT 3- Satt212 TCGATACCAATCATCCAATCCAAA 56 CGTATCCCTTTCCCATACGTGG 340 GTTTCTT 3 Satt213 TCCTTAGACCTCTCGCGCAAAC 57 ATGACGGGATGAAAGAGCCAAA 341 GTTTCTT 3 Satt216 TACCCTTAATCACCGGACAA 58 AGGGAACTAACACATTTAATCATCA 342 GTTTCTT 3 Satt218 ACGTATGCGAAGGAGGGAGATG 59 CGGAAAAGATATACCGAGTGAGAAAA 343 GTTTCTT 3- Satt219 TTGGCTCTTGTGTAAGTGGCCC 60 TTCTAAGGATTTGTGGTAATCGGC 344 GTTTCTT 3 Satt220 TTCAGTCCCTTGGTGGTTCCAA 61 CATGGAGAAAAGAAGAGGAGGGA 345 GTTTCTT 3 Satt221 CATGGTCCTTGGGTGCAATTTA 62 AAGCAAACCATTATCTTCATTGGTG 346 GTTTCTT 3 Satt225 AAAAATGTGTTAGAGCTTGTGTTGTTA 63 GCCCACACTATTCCAGCCACTAC 347 GTTTCTT- 3 Satt227 ATGGTGCAGTGTTGCAGGTTGT 64 AGTAGTCCAAACCGAAACGCCA 348 GTTTCTT 3 Satt228 GACCACAACTTCTTTTTTGTGAATGG 65 TCAATTCGGTCAAAAGGCTTGA 349 GTTTCTT 3- Satt230 CCGTCACCGTTAATAAAATAGCAT 66 CTCCCCCAAATTTAACCTTAAAGA 350 GTTTCTT 3- Satt233 AGAAGCATACTCGTCGTAACACTATCC 67 AATGGATGGACCTGTCAGTCTGC 351 GTTTCTT- 3 Satt234 GAGCAGGACATTTTTTTTATCCTTGA 68 TGCTTCCATTAGTCTCTCATCCTCC 352 GTTTCT- T 3 Satt236 TGCTTGAGGTTGAAGGAAATGC 69 TGGAAAAAGATAACGTGTGTTTGCAG 353 GTTTCTT 3- Satt240 TCCTTGGGGTGAATTGTTTTTCA 70 CCTTCTTTTGACATGGGGCCTA 354 GTTTCTT 3 Satt242 GCGTTGATCAGGTCGATTTTTATTTGT 71 GCGAGTGCCAACTAACTACTTTTATGA 355 GTT- TCTT 3 Satt243 AATGCTTTGGTCGTTGCATTG 72 TGGTATCGGGAGATTTTTTCAGC 356 GTTTCTT 3 Satt247 CAGCGTCTGCATGATAGCGTTT 73 TTTTTCGTCAGCACATTATTACACATTT 357 GTTTCTT- 3 Satt249 TGCAAATTGTTATTGTGAGACTGAATGA 74 GGCCAGTGTTGAGGGATTTAGAA 358 GTTTCT- T 3 Satt250 CGCCAGCTAGCTAGTCTCAT 75 AATTTGCTCCAGTGTTTTAAGTTT 359 GTTTCTT 3 Satt251 CCTCCACCCCCTTCCCACCCAAAA 76 GGTGATATCGCGCTAAAATTA 360 GTTTCTT 3 Satt255 AGCGTCGTCTGGCTAGGTCTGT 77 GGAAACCCTGTCATTTTCGTGC 361 GTTTCTT 3 Satt256 GTCATTGGTCTCAAACAATCTTCAT 78 AGAGTTCTCAGTCCGCCAGCTC 362 GTTTCTT 3 Satt257 GCGACTTTCTTTTCAATTTCACTCC 79 GCGCAATTGTCACCAACACAT 363 GTTTCTT 3 Satt258 CACTTTTTCACTGTCTCCCCCC 80 CCCAAACCAACAAGCAACAACA 364 GTTTCTT 3 Satt259 TGGGCCATTTGGGCAGCTCGACT 81 ATTCACACGCATCTGGAATAATA 365 GTTTCTT 3 Satt262 GCGCCCCATTAATGTTAACACA 82 GCGGAGTTCAACGCATTCACCTT 366 GTTTCTT 3 Satt263 GGAGAGAATCCATATATATTGAATTGC 83 TGAAAGCAAACGAGACTCATGGA 367 GTTTCTT- 3 Satt264 CCTTTTGACAATTATGGCATATA 84 GCATAGAAGGGCATCATTCAGAT 368 GTTTCTT 3 Satt265 CCTGTCAAATTGGCTGATGCAA 85 GCTAGATGAGCAGACCATTGCACTT 369 GTTTCTT 3 Satt266 TTTTACCAAACAAATTAAACTGCGTCT 86 CAAGAGGTTGTTGTAAGAGTGATCTCG 370 GTT- TCTT 3 Satt267 CCGGTCTGACCTATTCTCAT 87 CACGGCGTATTTTTATTTTG 371 GTTTCTT 3 Satt270 GGTGTTTCAAGTTTCAACACCAT 88 CAGTGCATGGTTTTCTCATGTACC 372 GTTTCTT 3 Satt272 ATGACAAGGAAAAATCAATCAAC 89 GCTGCTGTTAAGAGTGTTTG 373 GTTTCTT 3 Satt274 GCGGGGTCAATTAGTTTTCGTCAGTT 90 GCGCACGGTATATAATCGAACCTAT 374 GTTTCT- T 3 Satt279 GCGCAAAAGGACGCCCACCAATAG 91 GCGGTGATCGGATGTTATAGTTTCAG 375 GTTTCTT- 3 Satt280 TCTGCTTATTCATTGTGTGCGTG 92 TGTCTCCATGCTGTAACACGTCAA 376 GTTTCTT 3 Satt282 TGGTATATGTTTTTGCGGGACAA 93 CGCCAAAGATGCAACACACTTG 377 GTTTCTT 3 Satt284 AGGTGGGCTAGGAGTGACCACA 94 TGTAATTGCTGTTTTGGTTTCATTTC 378 GTTTCTT 3- Satt285 GCGACATATTGCATTAAAAACATACTT 95 GCGGACTAATTCTATTTTACACCAACAAC 379 G- TTTCTT 3 Satt287 GGGGTGAATGAATGTCAAGATGA 96 GCGCGAGGTATCAACACAATTACT 380 GTTTCTT 3 Satt292 GCGGAATTAGAACTCCAGTAAAGA 97 GCGAGGCCAACATTGAAAAGT 381 GTTTCTT 3 Satt295 TTAGTGGATCTACACTAAACTAATCCG 98 CGTACCATTGGACAACTCTGTAATTCAA 382 GT- TTCTT 3 Satt299 AGGCATTTCTGGCAAGGGTATG 99 TGGTGAATCAATCTCCTCTAAGTGC 383 GTTTCTT 3 Satt300 GCGCCCACACAACCTTTAATCTT 100 GCGGCGACTGTTAACGTGTC 384 GTTTCTT 3 Satt303 ATGGGCTATGGGAGGAGGTGTT 101 CCACACGGGACTTTCCATTTTC 385 GTTTCTT 3 Satt304 CCAGTGCAGTTTTACATGAACTT 102 TATATGTAATGACCCCCATCATG 386 GTTTCTT 3

Satt307 GCTGGCCTTTAGAACGTCTGACT 103 CGTTGGATTCGACTTTTTGGGA 387 GTTTCTT 3 Satt311 CCACAAAAAGATGAAACAAAATAG 104 TTGAAGCTCAGGCTGTGATGAAT 388 GTTTCTT 3- Satt314 GCGGAGATTCGAACCTACTCATTC 105 GCGGGGACCAAAAATTCAAAA 389 GTTTCTT 3 Satt319 AACAATTTGATGGTCGGGGTTG 106 TAGGGGAACCGATTTGGTGAAA 390 GTTTCTT 3 Satt321 CACCGTCGTAAAAACTGTGTCGT 107 GCGTGTCAAAGAGTTTTAGACATC 391 GTTTCTT 3- Satt327 GAAGTGCTAGTTCTCACGGTGTGG 108 TTGGAGGGAGGTTTTGGAAGGT 392 CTTTCTT 3 Satt326 TTCGCTGCATAATTTTTAGCATCA 109 CCAATCTTTTTGTTAGTTCACCTTCCA 393 GTTTC- TT 3 Satt327 AAAGAGACACCCAAAAGATAACAAACA 110 TTCGTAGCAATGTCACCACCTTGT 394 GTTTC- TT 3 Satt328 TGACCACCATGAGTTCATT 111 GGGGGTGGCTTTTAGATTC 395 GTTTCTT 3 Satt329 GCGGGACGCAAAATTGGATTTAGT 112 GCGCCGAATAAAACGTGAGAACTG 386 GTTTCTT - 3 Satt330 GTGACCCTCCATTCCACAACAA 113 TCCTTGCCTTTTAGTTGTTCGGT 397 GTTTCTT 3 Satt331 GCAGAGTCCCCCCTAAATATAG 114 CGGGAACAACCACACTCTCCATT 398 GTTTCTT 3 Satt332 GTGAATCATCCAGGGCTTGC 115 TCCTTCACTTTCAAAAACAAAAACAA 399 CTTTCTT 3 Satt333 GCGAATGGTTTTTGCTGGAAAGTA 116 GCGCAACGACATTTTCACGAAGTT 400 GTTTCTT - 3 Satt334 GCGTTAAGAATGCATTTATGTTTAGTC 117 GCGAGTTTTTGGTTGGATTGAGTTG 401 GTTT- CTT 3 Satt335 CAAGCTCAAGCCTCACACAT 118 TGACCAGAGTCCAAAGTTCATC 402 GTTTCTT 3 Satt336 AATTGGAGTGGGTCACAC 119 TTCCCGGAAAGAAAGAAA 403 GTTTCTT 3 Satt338 GCGCCCAAGTATTATGAGATATTTGAT 120 GCGATAATTTTAAAACTGGACCA 404 GTTTCT- T 3 Satt339 CTTTGTTTGGTTGGTGATAAGTTTCTA 121 AAGCAGTTCCTCTCATCACGTAACA 405 GTTT- CTT 3 Satt343 AATTGTTAGGGCGCGAGAAACA 122 CGCAATCCCAATTCACCTCTTC 406 GTTTCTT 3 Satt346 GTTCGGAGGGAGGAAAGTGTTG 123 CCATAAAACATAGCAACTGTCGTCTC 407 GTTTCTT - 3 Satt347 TGTTCAATCGACAAATAAGGGTGC 124 TCCCAGGGTAAAAGTTCAAGTTCA 408 GTTTCTT - 3 Satt348 CTTTACTTAGTAATGGTTCCCACAG 125 TCGATGTTTCTCCCTCCCTTAGA 409 GTTTCTT - 3 Satt352 CCAGATTTTACGTTAATGTTTTAGTTTTA 126 TTGCACATGGTCCTTGGTTGAT 410 GTTTC- TT 3 Satt353 CATACACGCATTGCCTTTCCTGAA 127 GCGAATGGGAATGCCTTCTTATTCTA 411 GTTTCT- T 3 Satt355 GCGTCCCAGGACATCATCATCATC 128 GCGTAGCGTGTTATTTTGTGTTTG 412 GTTTCTT - 3 Satt356 TGCTGCTTGTGTTTGGTTGATCT 129 CATATCCTGCCCCCCCAATTAT 413 GTTTCTT 3 Satt357 AATCCCCAAACAAACGCACAGT 130 TGACATCTAAGTCCAGAAATCAAAGCA 414 GTTTCTT- 3 Satt358 GCGGCGCTTTATGTAACAATACGATTT 131 GCGAGTAAAAGCAGAGTGCGGAGTA 415 GTTT- CTT 3 Satt359 GCGAGAAAATAATCCTGCTCAAG 132 GCGTTTAAGTCCAATAACAAAGATAAC 416 GTTTCT- T 3 Satt361 TCGGGAGACACTAAAGGCACTG 133 TCGTTGACACACAAAAAAAGCGA 417 GTTTCTT 3 Satt364 GCGGCATAAGTTTTCATCCCATC 134 ATCGGGTCATGACTTTTGAAGA 418 GTTTCTT 3 Satt367 GCGGATATGCCACTTCTCTCGTGAC 135 GCGGAATAGTTGCCAAACAATAATC 419 GTTTCT- T 3 Satt369 GGAGAAAAACATCCAAAGAAATGTG 136 CAAGTGGATTGACACACTAAGGTTTGA 420 GTTT- CTT 3 Satt372 GGATAATTTTTTCATCATCACAATTTATC 137 CACAAAAGACAGGAGATGTGAGCAA 421 GT- TTCTT 3 Satt373 TGGAAATACTGAATGAAAGCATATTGG 138 TTGTAGACGACTTGTGGTTCGATTC 422 GTTT- CTT 3 Satt378 CCATTGGGATCGAGAATAATTGATG 139 AATGAAGAAAATGTGAATTTGAAACCA 423 GTTT- CTT 3 Satt380 AGAGTAATGGCTCCTGCTCCGA 140 TTCCCTTTTTCTAACTCTCCTTTTTCA 424 GTTTCTT- 3 Satt383 CGATCTAACACGCATATTTCCTCTGA 141 TGTCTTGGTGCAATACCTGACATTT 425 GTTTC- TT 3 Satt384 TGGGGGTCAATTTTAATTTGTGC 142 ATTTCCCTTTCACCCACCTCTGTTT 426 GTTTCTT - 3 Satt385 GATTCTCTTCATTCTAATACTCGTTT 143 CAACGATCCCAGCTCACAGTTT 427 GTTTCTT - 3 Satt387 GCGTTACGTTTCACTATTTATTTAACAT 144 GCGGCAGGCTAGCTACATCAAGAG 428 GTTT- CTT 3 Satt389 GCTGGTGTATGGTGAAATCAAATTACT 145 TTTCAAACAAGGAAGAAACCTCTTTTT 429 GT- TTCTT 3 Satt390 TGATATTGTTTTGTGTGAAAGATGCAC 146 AAGTAACACTGTGGCGGCATCC 430 GTTTCTT- 3 Satt391 TGCTCAAAGGGTCAATTTCTTTCC 147 TGTGTAATTTCTATCACCTTATTGTGCC 431 GTTT- CTT 3 Satt393 CCAAGCCCATAAACGAAATAAAACA 148 TCCTTTGGCTCGGCCTATGTAA 432 GTTTCTT 3- Satt398 CAGTGCTCATATCAAATTAAAGTGG 149 CGCGGACTCAGTTAAACCGTAT 433 GTTTCTT 3- Satt399 TTTCAACCACCAAGCCAACCTT 150 CGTTCAATAGTTCCTATGATGGACGA 434 GTTTCTT - 3 Satt406 TGCAGCATGTGTTTTAGGCTTTC 151 GCATTGCACGTCGATTTTAGGG 435 GTTTCTT 3 Satt409 CCTTAGACCATGAATGTCTCGAAGATA 152 CTTAAGGACACGTGGAAGATGACTAC 436 GTT- TCTT 3 Satt411 TGGCCATGTCAAACCATAACAACA 153 GCGTTGAAGCCGCCTACAAATATAAT 437 GTTTCT- T 3 Satt412 ACTGGCGCTGACCTTAAATTGC 154 TCCTTTTAATTCTAACATTGAGACAGCA 438 GTTTCT- T 3 Satt413 TGTTTTTAAGTAATCCGGTGAAATAGCA 155 TCTGTCCCAAAAAAGAAAGAAGATATG 439 G- TTTCTT 3 Satt4l4 TCACATCACAAGTTTCATAAATGCTG 156 CAATCTTTAATGCTCTGGAGTTTGAGA 440 GTT- TCTT 3 Satt415 GCGTCTCCCTTAATCTTCAAGC 157 GCGTGTGACGGTTCAAAATGATAGTT 441 GTTTCTT - 3 Satt416 AGATTAAGAGAAGACGAGAGTTTTA 158 GGGTAATTTATCTGTGTGATTGTTC 442 GTTTCT- T 3 Satt417 GCCAGGTGCTCACTTCTTGCTA 159 TTGCTTGGGATTTTCATTTTATTATAGG 443 GTTTCT- T 3 Satt418 CAGGAGAAAAAAGGAAAAGAAAAGCA 160 GGTCAAAGAATAAGGGATTTGCCTC 444 GTTTC- TT 3 Satt420 AGGTTTTGCTTCTTGAAAGTGAAGAG 161 TGGGACTTTGATTTTTGGAATACCC 445 GTTTC- TT 3 Satt421 GTCTCCGTTCAAAGCTTCTTCTTC 162 CCAGAGAAATTATTGGAGTGGCAA 446 GTTTCTT - 3 Satt422 GAGGGGAGGTAAAAAGTCGGGA 163 GCGCAAAGAAATTCCCATCCTA 447 GTTTCTT 3 Satt423 CGCTTGGGTTCAGTTACTTGGTG 164 GGGAGAGGTTCAGTTGGGGAAT 448 GTTTCTT 3 Satt426 GCGCCCATTATTATTTTCCTTGAATTGT 165 GCGAATGCCTAATGTGATGATAAAAAAATA 44- 9 GTTTCTT 3 Satt429 GCGACCATCATCTAATCACAATCTACTA 166 TCCCCATCATTTATCGAAAATAATAATT 450 - GTTTCTT 3 Satt430 AATGCAAGAAGCAATCAGCAAGA 167 AATAATGGAGTGACCCGCTGCT 451 GTTTCTT 3 Satt431 TGGCACCCTTGATAAATAAGAGAAGG 168 TGGTACGAGTGGCACGAAATGT 452 GTTTCTT - 3 Satt432 AATTGAACCACTCAGCCAAGCC 169 GCCATCCTTTCCTTTCAACCAA 453 GTTTCTT 3 Satt433 GTCTAACATTTTAATTAGGGTGATTC 170 TGTAGGCTATTGGAAGGGTGCG 454 GTTTCTT - 3 Satt436 GCGTATAAAGAAAAACGAGCATATCAT 171 GCGCTTATAAAGGCTTGTGAAAGACACT 455 G- TTTCTT 3 Satt440 CAAATTGAAAAACACAAGAAAACACAA 172 TGGTTAGTGCAATCTTGGCGGT 456 GTTTCTT- 3 Satt441 AGCAACTAACCTTGGGCTTCAGTAA 173 TGCACCCATCAATCACATTTTTG 457 GTTTCTT - 3 Satt442 CCTGGACTTGTTTGCTCATCAA 174 GCGGTTCAAGGCTTCAAGTAGTCAC 458 GTTTCTT 3- Satt444 AATTCCTTTGGCATTTTTGTTGC 175 TTTTTTCTCACACCCATGCCGT 459 GTTTCTT 3 Satt445 TTTCACTTTTGAATCATTGCATCG 176 CCGGTTGGCGTAATGTGTCTTT 460 GTTTCTT 3 Satt448 CACCACTCGTATCCTTCACAAGAGC 177 GCCAGCAGCCTGTTCAGTTTTT 461 GTTTCTT 3- Satt451 GCGCAATTAAAAGGATAACTTATATC 178 CCCCTCTTTGGCCCTCACACCTTCTC 462 GTTT- CTT 3 Satt452 AAAATTCATGTCGCTGCGTTCA 179 ATTTGAAGCTCTTGGTATCTTGGC 463 GTTTCTT 3 Satt454 TGAAAACCATGTCAAAGTAATGGCA 180 CAACCATGATAAATGTGACTGAGCTTG 464 GTTT- CTT 3 Satt455 GGAAAGTTTTGTTACATGCCGGA 181 GTCACAATTTCACGATCCCAAA 465 GTTTCTT 3 Satt457 TTTTAACTGGAGAAACCTGAGGGA 182 TCCATTTTCCCTTTAGTCCAACG 466 GTTTCTT 3- Satt460 GCGCGATGGGCTGTTGGTTTTTAT 183 GCGCATACGATTTGGCATTTTTCTATTG 467 GTTT- CTT 3 Satt461 TTGCTTGCTGCACATGACTGAG 184 AATTTCTTACGTTTCCATAGATTTCTCG 468 GTTTCT- T 3 Satt464 TTGAAATAGTGGTGGGGTTGGG 185 TGCCCTCTTCCCAAACTAGGGT 469 GTTTCTT 3 Satt466 TGTGTTGTGTGGTGTGGTGGTC 186 CAACCACTGATTCAAGCCAACAA 470 GTTTCTT 3 Satt467 CAAAGTCCCCTTTCACACCTTTT 187 CAATTTAAGCACGGTCATATTTTCTCA 471 GTTTCT- T 3 Satt469 AAAGGGAAAGGAAGAATAAACCGA 188 CGTGATGCAGTGAATTTTTTTCG 472 GTTTCTT 3- Satt470 TGCTTTTTCTCTTTGGCAACCC 189 GGGTTACTTTTCTTTATCCTCCTCCA 473 GTTTCTT - 3 Satt471 GCGCCCAAAACTATCTAGTAATTCTT 190 GGGCTATCAAATTGACTAAAGCCAAA 474 GTTT- CTT 3 Satt473 CCAACAACCAAATCAATCACTGC 191 ACACTTGAATCATCGAGAGTTGCTAA 475 GTTTCTT- 3 Satt475 GCTCCGGTCCTTCAACTGACCT 192 TGTGCTGCTTGCTTCAATTTGC 476 GTTTCTT 3 Satt476 ATGTGGGTATGTTGCAGGCAGA 193 TGGCCTGTCTTATATTACCGAACCAA 477 GTTTCTT - 3 Satt477 GTTGGGAAAAGGTTACTACCATATC 194 GGTCCGTATGCAATTCTTGACTAATA 478 GTTTC- TT 3 Satt478 CAGCCAAGCAAAAGATAAATAATA 195 TCCCCCACAAGAGAACAAGAAGGT 479 GTTTCTT -

3 Satt479 GCGCTTTCAAAAAGTAACAATTAATGAAA 196 GCGGGAATTGGTTAATCTCATCGTGAC 480 - GTTTCTT 3 Satt480 GACCTTTCATCATCGTCCCCAC 197 TGCGAAAAAGCAGAGTGACCAA 481 GTTTCTT 3 Satt487 TCAATTCATCACGGACCAGTTCA 198 TGAGCATATTTTGATCCGATGCC 482 GTTTCTT 3 Satt488 GTGAGTTTCGGTGCTGTATTCC 199 GTTGCTTTGTTATGTAATGGAAGTC 483 GTTTCTT 3- Satt491 CCTAAATTGATGAAAGGATACAAG 200 GCCCCACAAATATTCAGAAGGTAA 484 GTTTCTT - 3 Satt492 GTATCGTTCGCGTCTTGAGTC 201 GCAGCGGTGTAGTTCGTTCTTTCT 485 GTTTCTT 3 Satt493 TTAACGGGAAAAAATTAAACCTACGA 202 AAATCGTCTTTTGTGGCTGCCT 486 GTTTCTT - 3 Satt495 TGGAGATTTAATATAGATGCCGCGA 203 GCACCATGTTCTTTTTCCATCAAA 487 GTTTCTT- 3 Satt497 GCGGTTTTGGATTGACTTTGTTGA 204 GGCTCAATTAGAGCATGCAACATC 488 GTTTCTT - 3 Satt503 CCGTGACTTTTGTTATCCTGAGTTCC 205 CATGTTAAACGTCCACCCACCA 489 GTTTCTT - 3 Satt506 GCGAATTGGCATACATAGTACC 206 GCGTGAATTCGCCTAAGTTTAT 490 GTTTCTT 3 Satt507 TGCACCACTAATGTCCTCAGCC 207 TCCCTACTCTCGTGTCGTTAGTTATTTT 491 GTTTCT- T 3 Satt508 GCAATGGGTATTGATCGTGTCA 208 AGTTACATTATTTTTGTCTTTCTGCCGT 492 GTTTCT- T 3 Satt509 GCGCTACCGTGTGGTGGTGTGCTACCT 209 GCGCAAGTGGCCAGCTCATCTATT 493 GTTTC- TT 3 Satt510 GCGAGTTTCGCCGTTACCACCTCAGCTT 210 CCCTCTTATTTCACCCTAAGACCTACAA 494 - GTTTCTT 3 Satt511 TGCGACTTTACTGAAAACCTGGAA 211 GGAAATGCTTCAAACCAACAAACA 495 GTTTCTT - 3 Satt512 AACGTCTTCAAGTCAAGTGCCTACA 212 GCCCACATAGTTTTCATTTTTCTCCA 496 GTTTC- TT 3 Satt513 GCGCATCACAAGTTTTATAGATGCTGA 213 GAGGTCTAGTGCTTTGGTAAGGTT 497 GTTTC- TT 3 Satt514 GGGTACATTTTATTAAAAGTAAACACACC 214 TGTCACACAACCAGTGTCTCAAAATC 498 G- TTTCTT 3 Satt515 TGAACCTTGTCTGTTGATTTTTTTATGT 215 CACACCCCAGGACCCATTAAGA 499 GTTTCT- T 3 Satt517 TCTCCTACTTCTCTTTCTCCCGTTCA 216 AAAGCGCACACAATGCAAATACA 500 GTTTCTT- 3 Satt519 CCTGATTATATGTCTAGACAAACAT 217 CAAGGTTACGAACTGCTCGAATAAG 501 GTTTCT- T 3 Satt522 GAGATCACATCAAAGTCAAAACTGCC 218 TGAGGAGGCAAGATGATCCAAA 502 GTTTCTT - 3 Satt523 GCGATTTCTTCCTTGAAGAATTTTCTG 219 GCGCTTTTTCGGCTGTTATTTTTAACT 503 GT- TTCTT 3 Satt524 GCGAATTATCCAAAGATACACTTAGTC 220 GCGGGTCTTACGAACGTGTCACATTAT 504 GT- TTCTT 3 Satt526 ATATCGAAAATCGCGCATCTGG 221 CGAACCCAAACCACAAAGCATA 505 GTTTCTT 3 Satt529 GCGCATTAAGGCATAAAAAAGGATA 222 GCACAATGACAATCACATACA 506 GTTTCTT 3 Satt532 GCGCCAATATTATCATGCTTTATGT 223 GCGTGTAAAAATCTTTGAATCTTGA 507 GTTTCT- T 3 Satt533 AGTGGTCGTCACAACACTATCATAT 224 CACCCATTATTGAAAATACAAGGACCA 508 GTTT- CTT 3 Satt534 CTCCTCCTGCGCAACAACAATA 225 GGGGGATCTAGGCCATGAC 509 GTTTCTT 3 Satt536 GCGTGGAATGAGAGGTAACCAA 226 GCATAATGGTCTAATAAAAGTGGAGACC 510 GTTTCT- T 3 Satt537 CAAAACTTATGTGCAACACGACTTCA 227 TGCTTTTGGAGGAACTTTGTCTCA 511 GTTTCT- T 3 Satt540 AATGTAGCAATTTGACTGGCGAA 228 CATTCAACCGTGATTGCGAAGA 512 GTTTCTT 3 Satt543 GCGGATCTAAGGATAATTCATTAA 229 GGGAGCGGATCATTCGGTGAAA 513 GTTTCTT 3 Satt544 GCTATGGGAAAAGGATGTGTG 230 GAGCTACCCGAGATGATACTC 514 GTTTCTT 3 Satt545 ATGTGATGGCATGTGAAATGGT 231 GGATCAAATTGGGAAACACAAAGG 515 GTTTCTT 3 Satt546 CAGGGTATAGTTCAATTCAGTGAGCG 232 CTCACATACATGGCAGCCGTAA 516 GTTTCTT - 3 Satt548 CCTCTTTGTTGGTGGTTAAGTCTCC 233 TGCCTTTAGCTGGTGGGAAAAA 517 GTTTCTT 3- Satt549 GCGGCAAAACTTTGGAGTATTGCAA 234 GCGCGCAACAATCACTAGTACG 518 GTTTCTT 3- Satt550 TCGTCAATTAAGCAAAAATGTGAGA 235 TTAGAGGTTTTCGGATGAGCGTG 519 GTTTCTT - 3 Satt551 GAATATCACGCGAGAATTTTAC 236 TATATGCGAACCCTCTTACAAT 520 GTTTCTT 3 Satt552 ACAAAAAGAAATCGAACCGGCA 237 GTTTTGGTTGATCCGCATTGGT 521 GTTTCTT 3 Satt555 TGGCTTTGATGATGTTTGAGACAA 238 TTTCATTACCGCATGTTCTTGGA 522 GTTTCTT 3- Satt556 CCCAGATACAGACAATAAAACCCGA 239 TTATGTTCGTTCATCTCTGAAGCCT 523 GTTTCT- T 3 Satt557 TCCACCATGTAATATGTGAAGTGGAT 240 TTCTGTCCATTCTAGCTCACTAACCC 524 GTTT- CTT 3 Satt558 CTCACACCCTTTCATTATCTA 241 AAATCGCGCATCTAAATTTAC 525 GTTTCTT 3 Satt560 ACTCTATTTTATTATCGTGCAAGAA 242 ACAATAACTTGTTTTGCACACTATT 526 GTTTCT- T 3 Satt563 GATGACAACGTAGGCTAAAAA 243 GCGCCCACATGATTTTGTACTGAT 527 GTTTCTT 3 Satt565 GATTCTATATCCATCGTGTTGCT 244 TATGGTAAATATTAACCATTGTCCT 528 GTTTCTT - 3 5att566 CCCACTGTATCCTTAGTGTGCCA 245 CCTCGTTTTATTCCGAAAGCCG 529 GTTTCTT 3 Satt567 GGCTAACCCGCTCTATGT 246 GGGCCATGCACCTGCTACT 530 GTTTCTT 3 Satt568 CATTAACTAATAAGTTGTTGGTAGC 247 TTAGATTCGGACACCGGTCTACT 531 GTTTCTT - 3 Satt569 ACCAAATTGCTTCACGCATCC 248 TCTTAATTTTTTTAGGAATGGCATCAA 532 GTTTCTT - 3 Satt570 TGCTCATGTGGTCCTACCCAGA 249 CGCTATCCCTTTGTATTTTCTTTTGC 533 GTTTCTT - 3 Satt572 GCGGAGCATGTAAATCCAGCCTATTGA 250 GCGGGCTAACTTATGTTACTAAACAAT 534 GT- TTCTT 3 5att573 GCGGATTTCGATTTGAATATACTTAC 251 CCTGTGGCTGTTATACTATGCATATA 535 GTTT- CTT 3 Satt576 TGGACACACACAAACACCTACAGAA 252 GGGTGGCGTTGACAATGTTTTA 536 GTTTCTT 3- Satt577 AGCAAGTCTTGAGTCTTTTGTCT 253 TTATTATCTAAACTTATATGTGCAT 537 GTTTCTT - 3 Satt578 TCCCACGTCATATCCACTGCTC 254 GCCTCCTAAGTCCGTACACAGCAT 538 GTTTCTT 3 Satt581 CCAAAGCTGAGCAGCTGATAACT 255 CCCTCACTCCTAGATTATTTGTTGT 539 GTTTCTT - 3 Satt582 CCGGTGATACTCCATACCAATAACA 256 GGATTTGGTTTCTGTGTGCTGTG 540 GTTTCTT - 3 Satt583 CCGAGCTAACAAAGGCGACCAAAT 257 GGGGCACAAGCCACACTT 541 GTTTCTT 3 Satt584 GCGCCCAAACCTATTAAGGTATGAACA 258 GCGGGTCAGAAGATGCTACCAAACTCT 542 GT- TTCTT 3 Satt586 ATGGCCGTCTCAAAAGAACTGG 259 TGGGCACTTGCAGTCCAAATAG 543 GTTTCTT 3 Satt587 GCGAATGGTTGCTCAAATAATC 260 GCGCAAACCGCACAAGTTTATGT 544 GTTTCTT 3 Satt590 GCGCGCATTTTTTAAGTTAATGTTCT 261 GCGCGAGTTAGCGAATTATTTGTC 545 GTTTCT- T 3 Satt591 GGCAGACTCGTAGAGCAATTTA 262 TGTTGAAATTGACCAAAATTCCCA 546 GTTTCTT 3 Satt592 GCGAAGATTGGTCTTTTATGTCAAATG 263 GCGGAGGAATACAAGTCTCTATTCAA 547 GTT- TCTT 3 Satt594 GCGGTAACTCCTCGAGTCCCTCTCAAT 264 GCGCCGCTAACAGACATCCAATA 548 GTTTCT- T 3 Satt595 TGGTGATGGGAAGCAAACAAGA 265 TGGATTTCACCCAAGAAAAAAGC 549 GTTTCTT 3 Satt596 CCATCCCTTCGTCCACCAAATA 266 TCGACTACCCGTCGATTCCGTA 550 GTTTCTT 3 Satt597 TGCTGCAGCGTGTCTGTAGTATAATTT 267 GGCACAACCATCACCACCTTATT 551 GTTTCT- T 3 Satt598 CGATTTGAATATACTTACCGTCTATA 268 CACAATACCTGTGGCTGTTATACTAT 552 GTTT- CTT 3 Satt601 GTAACATTGGTTGTCATCTTTGTCTA 269 ATCGAACTGTGACCGTCCCTTC 553 GTTTCTT - 3 Satt602 GGAGGTTATCTAGTGGTATAGATGGT 270 AAGGGAAGAGAGTCGTGCTTCTTT 554 GTTTCT- T 3 Sct_010 CCAAAAGCATTGAGAGTGGGGA 271 CCAGCAAACCCCCAGGTAAAG 555 GTTTCTT 2 Sct_026 GAAACCCGAAACGCAAAATCTC 272 GAAGAAAACGCGAATAACCCCA 556 GTTTCTT 2 Sct_028 CTCTCGCCGGTACAAAACACCT 273 GCACGCAGACTCAAGTTCATTCA 557 GTTTCTT 2 Sct_034 TCACTCTGACAACTTCAATCTCTTTCTC 274 AATAGTTGGGTCGTCGAAGGGG 558 GTTTCT- T 2 Sct_046 CACGACTCTTCCTCTTCCTCCG 275 TCCAACTTAACACAAGATCAGCGAA 559 GTTTCTT 2- Sct_065 CCCTGTGTTTCCCTCT 276 GAAAAGTTTTATGTTCTGAGTG 560 GTTTCTT 2 Sct_137 GTGTTGCTCTTGGGAATCTGCC 277 CCACACACACTGACACAGTAAACCA 561 GTTTCTT 2- Sct_147 TCTCGACTCACGACTCA 278 CCAAGGTCTCTCAGAGG 562 GTTTCTT 2 Sct_186 AAAATGAAAACACACAGAGAGAGAGAGA 279 ACGGAGGCACTTCCCATTGTTA 563 GTTTCT- T 2 Sct_187 AGCGAAATGTGTGGTCCAAGGT 280 CAAAACGACATGACAAGGAAACTTCA 564 GTTTCTT - 2 Sct_188 CGTCGAGAAAGGAAGAGAGGCA 281 TCCTCCATAAAAATTAAAAACATTGGAA 565 GTTTCT- T 2 Sctt008 GCGGAAACCATTCTGACGGATA 282 GCCCCCAGACACAACATAATCA 566 GTTTCTT 3 Sctt009 GGAGGAACTTGGAAGGCATATCA 283 CGAGAGAAGCAGAAGCAGAGGC 567 GTTTCTT 3 Sctt012 ACGGACAACGCTGGCACTAAG 284 GAGAAAGGTGACGATGGACGCT 568 GTTTCTT 3

TABLE-US-00018 APPENDIX III ASH marker primer sequences 2 pages Primer 1 Primer 1 sequence Primer 2 Primer 2 sequence SEQ ID Marker Name Primer 3 Primer 3 sequence NO P10355B-1 19392 CATGGTTTCTCTTATCTTAT(AG)ACATTGTTGCCAAG 569 19393 CAATTCATGGTTTCTCTTAT(AG)ACATTGTTGCCAAG 570 25400 CACTGTCCCTGCTCCTGTTTCAAGTATC 571 P10598A-1 14507 CAATTCTTGTGGGTTGAAGCCTTGTTCTGAC 572 14505 GGAATCAACTTCTTCGTGAGTGGGTTGTTC 573 P10615A-1 1125 TGGTGGCTATGGAAATCTCATGTGTGGA 574 4186 CTCTCATTTACCAAACTCCAACATTTGATCACC 575 P10618A-1 14492 CACACTGGTAGATGGGAAGCAAGAATAGG 576 14490 GAAGAAGATTCCACCCAGATCATCATCAGTAG 577 P10620A-1 12099 GCTTGTGCAGCTCCAATCGGTGTAAC 578 12101 GTGCAATCCAAGACATCTGGTTCGGAC 579 P10621B-2 12158 CAGCTAAACCTTACAAGGATGATTGGTCAAG 580 12159 CCCTGGACTGAAGTTGCCATAATGTATC 581 P10623A-1 12153 GCTGGTTGGGAGAAAGCACTTCC 582 12154 GAATCTAACATTACGCTCTGCTGGAGTATC 583 P10624A-1 14328 GAGGGACTATGTGAAATGGAGAGGAGTG 584 14330 GTATGCTAAAAGAGGAGACTTGACTGGTGAG 585 P10632A-1 12105 GATGAAGGAACCAACACTTGCATAACAATTTG 586 12106 TGTCAGCACTCCTCACTCATTTGCCGA 587 P10633A-1 4187 CACTTAACAGGAGTGCTCCTGATCACCAG 588 1183 GAGAACAAGGACAAATCAATAGGTGAGACGAAGAAA 589 P10634A-1 12600 CTCATCTGCTCAGAACCTTCAGTCAGTC 590 12601 CGGATCATGTCTAGTACATTAGAGATGCTTGTG 591 P10635A-1 12779 CTACACTTCTAATGCCTATTTAGGTGTGCTTG 592 12780 GTCATATCTAGGGAGATTTCTAACCAGTTGTC 593 P10636A-1 15252 TAGGCAGCGTGACAAACTGAGCATAGG 594 15258 GGGTTGATGTCCGATGGGTAAATGAAGTTG 595 P10637A-1 14136 GCACTAATACTTTAGTTGACTTTTGAGGTGGTTGAG 596 14138 GCTATGTGGTAGAAGTATATGAAAAGGTAGATGACAG 597 P10638B-2 15290 GAATATACTAGCTTGATGCCTATTTGTTTCTAAACCC 598 15040 AGCAGTCATACAATGCTCTTTATTGTGGTGAAG 599 P10639A-1 15345 GCTCATAGCCTGCTTCTTAATCTTGTTATTCTG 600 15347 CTATTTGTTTCAGGAGTTTCACAACCATCTCAAGT 601 P10640A-1 15280 CATCTTGACCAGTCACCAATCTGAGTACAG 602 15281 GGCTTCAGTGAGAAAGGTGGATCAAATGGA 603 P10641A-1 15349 CAACGTGTAAAATCAAGAGATTGAGCTTCTGG 604 15350 TCGGTGTGTTCAACTATGACTTTGGTTCTG 605 P10646A-1 5642 CCCCCAACAAAACTAAAAATAGAACCCTCAACAACC 606 6803 GGTCCAAGAACATTATGATCTTGAACAATCTTCAC 607 P10648A-1 14436 TGGCTAGAGCATCAACACATCTATACCTTC 608 14333 CATTGGGCATGATTCTTGAATAGCCTTTTTACC 609 P10649C-3 12171 GAGGGCTATGTTTTCTTCTCCAGATGTGAG 610 12173 AAGGTCGGCTTGGTGGTTAAAGGCAG 611 P10651A-1 10414 GCCTTTTATGCACATTTTTCCTGGGGATCTAAC 612 10415 CTCAATGTCATGGGATCAATTTGGAAATTCAATGACC 613 P10782A-1 15294 GATTACATTAATTACCGCTATGACTATATCTTGGGAC 614 15296 GCTACCTTCTCCATTGCTTCTATGTATTGGTC 615 P10783A-1 15771 GGGCATCACATACATGAAAACAACTACACTTG 616 15772 CAACAGCTCTCTTCCACCACAATCCTG 617 P10792A-1 15805 GAGATTGGAAATTGTAGCTCTCTTTACTTGCTG 618 15807 CTTTGAGGACTTATTTGGTTGTTATAGGCATTTGG 619 P10793A-1 15621 GTGTTTCCCTCCATTTTTGCCAAAAGACAG 620 15814 TATACACACTAAGAATTCGCTCGCTGTACAA 621 P11070A-1 16188 GGTCTAGACTTTCACTCAGACAAGGAAC 622 17490 CAAAATACTACAGACCTAATTTGTAACTAATTGCTCCC 623 P11347A-1 9642 GGGAAGAAGAAGAACACTCGGTACAGTAG 624 7693 AAGCTAGGAAATCCACACTCAAATTATCGACTTGTGT 625 P12105A-1 23538 GACCTGAAGCAAAACGCCACCATTTCC 626 29311 CGTTCGAGACGACGCCGTTTGATTAC 627 P12198A-1 39113 CAGTCGACACGTCTTCTACTCC 628 39114 TGGAAGGCATGTCGGAACTTG 629 P12390B-1 21397 CCTTTTTGCCCTCACTTCATGCCTTCTATG 630 23525 GCATAACCCAAGAGCTGGACTGACAAG 631 P12391A-1 21215 CAAGCTCTGCTGCCAGGTTAAGTGTTTC 632 21216 GACTAGAACAAATTGGGGCTAGTGTGTTTGAG 633 P12392A-1 21494 TGGACTTGCGGGACTATGCCTTAGAG 634 21495 GCAGGAACACGTTCGTAACCATCAACTG 635 P12394A-1 22161 GTCCCTTTCTGAACCACTTAAAGAGTCAACAG 636 22163 GGCATAGTGAGTTGAATACCAGGAGGAATC 637 P12396A-1 23679 ATTGAAGGGTGGGCGTTACCAGGTTAC 638 23680 GAGTTAATGGGGCTATGCTATTGGCTATTCAC 639 P13069A-1 24588 GTCACTATATGGAGTCAAGGTAATTATTGTGTTCAC 640 24590 GGTCTAGAGTTTGAATATTAGTAATGACTTGTATTGAC 641 24591 GCATATTGTGCCATAGAGAGAGAAAATGTAGTAAG 642 P13070A-1 24508 CGCTACTGCAAGTTATCAGTCAAGAGATTATTCC 643 24510 GCCGTGTAAGCGTGTTTACCAATCTAGTTG 644 P13071A-1 24795 CAAAACTGAGCGAAACTTGTGTTGGGAGAAAG 645 25395 GTGGGGACTCTTTATTCGAAGTTTGCTGAAC 646 P13072A-1 24499 CTCATGTAACCAACTCTCTATGAAGTTTGAGATCCA 647 24500 CTCTAATCGGATTTGGTGTTTCACTTCGGTAAG 648 P13073A-1 24503 GATGGCTGTCATTGCTACAGAGGAGTATC 649 24505 GTGACTCCAAAGGAAAGAGAAATGTTTCTTAAATCATC 650 P13074A-1 25287 GGATAGCAAGTCAATTTCATGCCTTGTGATAG 651 25288 GCAGGACATGAAGATGTACTTAGTGAATGTGAAG 652 P13158A-1 24713 ACTGGAAGAGGGTGCTTAGGGAATCTG 653 24715 GAGAATCTAGTCTACCACCATACCACGAAC 654 P13560A-1 25671 GGGACTCTCTTTATATTGGAAGGTATAACTCAGTG 655 25672 GTTGGACCCTTGTAATTAGACCCGAAACAAATG 656 P13561A-1 26537 ATCTGTCCAACGATCTCTCCATGTTCATTC 657 27121 CGAATAAGAAGTTGGGTATCACTTACACGTTGG 658 P2447B-2 8815 GATGGGGTTCTAGACTGGGATCTGGAT 659 8616 CTTTTCCTACAGGATTGTCAGGCTTATCGTCA 660 P2481A-1 10468 GAAGAGTAACAGAGTCTACGCACCGAC 661 10470 GTCAACGAACATACTATGCATGATGATTTCTGATTAG 662 P2636C-2 21190 CATATGCAGACAGCAGGCTAAGGAACTC 663 15824 GCAGCAATATAACCAGGATTCAGAATTAATCTAGTTAG 664 P3050A-2 16940 CGATGGGGTTGACTTAGAAATGGCATATAC 665 16860 GCACCAATTCCTCAAGCATACTCCAAAC 666 P3436A-1 10660 CTGACAAGGTGTTTTGGTAGGGAGAGATTC 667 10663 GCATCCTCCGTTACTCCAATCAGAGTTTCCAT 668 P3436A-7 10660 CTGACAAGGTGTTTTGGTAGGGAGAGATTC 669 10663 GCATCCTCCGTTACTCCAATCAGAGTTTCCAT 670 P5219A-1 11913 CACACTATCAACACCTATTGGTGACCATTGTA 671 8395 GGAGGGTGCTTATGTAAATGATGTAAAGACCAT 672 P5219A-2 11917 GATGACCATTTTGATTCCCTCATGCTATTAGTACC 673 8396 CCAATAAGTTAGCAGCATGTGGATCACAGTGTA 674 P5467A-1 19156 GTCTCTCGGAGTTGCTTCAATTGCTCATAC 675 19864 GAGAGTGTGGAATTGTA(AG)TCATTGATTGAAAACTC 676 P5467A-2 19156 GTCTCTCGGAGTTGCTTCAATTGCTCATAC 677 19864 GAGAGTGTGGAATTGTA(AG)TCATTGATTGAAAACTC 678 P6181A-2 17279 GCAGAAGGAGCATTGAGGCTTTCCAG 679 9372 GAAAAGGTTTGTTATGCTTCGTACTCTGTCTC 680 P7659A-1 7847 CATGAAGCTCCACCATTTGCTAGTACATGAAAC 681 10878 CCAGAGTTACCAAACCATCTGTGAGAAATATCC 682 P7659A-2 7847 CATGAAGCTCCACCATTTGCTAGTACATGAAAC 683 10878 CCAGAGTTACCAAACCATCTGTGAGAAATATCC 684 P8230A-1 13958 CAAACGCTCCCAACAGCTTCAGAATCTC 685 13959 TTGAAGGTTGTAAGAGTCTCGGTCGTCG 686 P8584A-1 15081 CCCATTCTTCATGTACTCATACACCAAGAG 687 15086 GCAGCCACCAATAATTTCTCATTTGACAACAAG 688 P8584A-2 19660 CTCTGTATATGAYATATGTGCTCAGTGCCTC 689 19389 GACTTACCAAATGAGTTTGACCAGGTTTTACC 690 P9026A-1 14494 AGGATTCAACCTCTAGCCATGATGATGTTG 691 14493 CCAAGCTCTTTCCGTGTGTATCAATCTG 692

TABLE-US-00019 APPENDIX IV ASH marker: probes 2 pages Probe 1 SEQ ID Probe 2 SEQ ID Probe 3 SEQ ID Marker Name Allele1 sequence NO Allele2 sequence NO Allele3 sequence NO P10355B-1 18119 GTTTCAGATAAC 693 18118 GTTTCTGATAAC 754 P10598A-1 13358 GAATGACTTTGA 694 13360 GAATGATTTTGAC 755 P10615A-1 1630 TCATTCTTTCATG 695 1629 TCATTCTTTCATG 756 P10618A-1 13392 TCTCCAGAAACA 696 13394 GTTTCGGGAG 757 P10620A-1 13919 GTGATCCGTG 697 11141 ATCACGAATCAC 758 P10621B-2 11150 ATCTTTTCAGGTT 698 12304 TATGGAGTAATTG 759 P10623A-1 11360 GGATTACATACTA 699 11361 TGGATTTTATACTA 760 P10624A-1 13361 TTTGAAGCTTTAT 700 13362 TTTGAATCTTTATC 761 P10632A-1 10697 AAGAATCTTCGTA 701 10698 AAAGAATATTCCTA 762 P10633A-1 15132 AATCTAAAATTTAGT 702 15131 ATCTAACATTTAGT 763 P10634A-1 11987 ACTAAATTTATACC 703 11988 GGTATACATTTAG 764 P10635A-1 12562 ATTAGGGGCAG 704 12563 ATTAGGGGGCA 765 P10636A-1 13678 ACTATAGTTCGC 705 13679 ACTATACTTCGC 766 P10637A-1 13428 AACCTTTCTGTC 706 13430 ACCTTGCTGTC 767 P10638B-2 12041 TTGAGGATTTAG 707 12042 TTGAGCATTTAG 768 P10639A-1 15144 TCTCAACTTGGA 708 15145 TCTCAATTTGGAA 769 P10640A-1 15137 TTCAGTCAAACC 709 20442 TTCAGTTAAACC 770 P10641A-1 13673 TTCTTTTGTGACA 710 13675 TTCTTTGGTGAC 771 P10646A-1 6223 TGTGACAACCGA 711 6224 GTGACACAACC 772 P10648A-1 14935 AATCTTTTTTAAAG 712 13666 AATCTTCTTTAAAG 773 P10649C-3 11356 TCATCTCTGATAA 713 11358 TCATGTGTGATAA 774 11357 TCATCTCTGA- TAA 815 P10651A-1 8002 AAGAGAAGGCTA 714 8003 AAGAGATGGCTA 775 P10782A-1 15302 ATATAAGTAAGGG 715 15301 AATATAAATAAGGG 776 P10783A-1 15599 GCATGTCGAC 716 15600 GCATCTCGAC 777 P10792A-1 16759 TTGGAAGTTATAC 717 15707 TTGGAAGATATAC 778 15706 TTGGAATATA- TACT 816 P10793A-1 15624 GGCATGTGAGT 718 15625 GGCTTGCGAG 779 P11070A-1 14956 ATTAACAGTAAAGT 719 14957 TATTAACATTAAAGT 780 P11347A-1 15073 TATCTATGTATATTA 720 17277 TATCTATATATATTAA 781 P12105A-1 23530 TGGGAATGATG 721 21919 ATCATCCCCAA 782 P12198A-1 23164 TAAATAAATAAGATG 722 23165 AAATAAGTAAGATG 783 P12390B-1 21475 AAAAAAAATGAGG 723 23524 AAAAAATATGAGG 784 P12391A-1 23527 TCAATGTTGGAT 724 21219 TCAATGATGGATA 785 P12392A-1 21493 TTGTGACCAATAT 725 23437 ATATTGATCACAA 786 P12394A-1 23401 ATCAAGCCCAA 726 23529 TGGGTTTGATC 787 P12396A-1 23681 AGAAGCTCGTG 727 24579 GAAGGTCGTG 788 P13069A-1 24584 GAAAAAGAAAGG 728 24585 GAAAAAAAAAGGA 789 29603 AGATGTTAGAG- TTA 817 P13070A-1 24509 ACATATAATAGTAG 729 25336 ACATATAGTAGTA 790 P13071A-1 24796 TTTTGTATCTGTAT 730 24798 TTTGTGGCTGTA 791 P13072A-1 25337 TTAACTTGCCAG 731 25338 TTAACTAGCCAG 792 P13073A-1 24504 AATGATAATTTAGT 732 24506 AATGATCATTTAG 793 P13074A-1 25306 GAATGAATTTTTC 733 25307 AATGAACTTTTTC 794 P13158A-1 25339 ACACTGCTTAC 734 25700 TTTTTGCTAGAG 795 P13560A-1 25673 ACAACTAATAAGG 735 25674 TACAACTAAGGTA 796 P13561A-1 26309 TTCTGATAAAAAAA 736 26310 TCTGATGAAAAAA 797 P2447B-2 11878 TGTAATGCGTG 737 8378 TGTAACGCGTG 798 12003 TGTAACGCATGT 818- P2481A-1 5486 GACAATCTAAAAA 738 7441 GACAATTTAAAAA 799 P2636C-2 14678 TAATAATAATTGTGT 739 15823 AATAATGATTGTG 800 P3050A-2 16760 TTCCTTCTTTTTTT 740 16761 TCCTTCCTTTTTT 801 P3436A-1 10239 GGAACGTTACC 741 10240 TGGAACATTACC 802 P3436A-7 18078 AATTTTTTAGTATG 742 14278 AATTTTTGAGTATG 803 14617 ATTTTTTGG- TATG 819 P5219A-1 7700 TTATAGACACTTG 743 7699 TATAGGCACTTG 804 P5219A-2 7944 ATAAACCATATATG 744 7943 ATAAACCTTATATG 805 P5467A-1 18980 TTAATTACCTTAAG 745 18981 TTAATTATCTTAAG 806 P5467A-2 20239 ATGCCATTTTG 746 19197 ATGCCCTTTTGT 807 P6181A-2 9448 TAATATCTTATGCA 747 9292 AATATCGTATGCA 808 P7659A-1 7858 AGTGCGATGAAA 748 7859 AGTGCACTGAAA 809 P7659A-2 10390 GAGGAGATGTAG 749 7845 AGAGGAGATGTA 810 P8230A-1 10586 TAAAATTGTTGGTT 750 14933 TAAAATTATTGGTT 811 P8584A-1 14786 TGAAGAAAAATATG 751 14787 GAACAAAAAGATG 812 P8584A-2 20517 CTGTCCACTAA 752 20358 ACTGTCAACTAA 813 P9026A-1 14340 AGAGGCAGTGA 753 14341 AGAGCCAGTGA 814

SEQUENCE LISTINGS

1

819122DNAArtificialsynthetic synthetic oligonucleotide primer 1caatcaggtt agtggtccta cc 22222DNAArtificialsynthetic synthetic oligonucleotide primer 2aagttcacag cacctggacc at 22322DNAArtificialsynthetic oligonucleotide primer 3gaaacaaaca cccccaaggt ga 22422DNAArtificialsynthetic oligonucleotide primer 4ccaatcgtgt cttatcctcg gg 22523DNAArtificialsynthetic oligonucleotide primer 5ttccagacag aacccaagta gcc 23624DNAArtificialsynthetic oligonucleotide primer 6aacatttttc atcgcttttc ttag 24724DNAArtificialsynthetic oligonucleotide primer 7aaagcatttt tggcagtttc ttgt 24825DNAArtificialsynthetic oligonucleotide primer 8tggacagaat ggagaaagaa atgtg 25922DNAArtificialsynthetic oligonucleotide primer 9ccaagccaaa caaagaatca ca 221027DNAArtificialsynthetic oligonucleotide primer 10gcttgctatg attgattgat tgattga 271125DNAArtificialsynthetic oligonucleotide primer 11agaacggtgt taagatagaa tagtt 251226DNAArtificialsynthetic oligonucleotide primer 12gggaagctta ataatgaaaa tgacac 261322DNAArtificialsynthetic oligonucleotide primer 13aaccgatgct tttttcgcct tt 221423DNAArtificialsynthetic oligonucleotide primer 14gaagaaggct cagcaacacc ttg 231523DNAArtificialsynthetic oligonucleotide primer 15cacccaatct tgcctttgaa aca 231626DNAArtificialsynthetic oligonucleotide primer 16tagacacttt caggttaaaa tataac 261726DNAArtificialsynthetic oligonucleotide primer 17caacttgtca cttacacata gtttag 261822DNAArtificialsynthetic oligonucleotide primer 18atttcgctcg caaacacaag gt 221927DNAArtificialsynthetic oligonucleotide primer 19tcaagaaata caagtgcaag aaagacc 272022DNAArtificialsynthetic oligonucleotide primer 20aattttcgct tgtgaaccct gc 222128DNAArtificialsynthetic oligonucleotide primer 21ttcagtacaa gtcgggtgaa taataata 282222DNAArtificialsynthetic oligonucleotide primer 22tgggactctc acacacggaa aa 222323DNAArtificialsynthetic oligonucleotide primer 23tgggagtcaa tttcccatta tca 232428DNAArtificialsynthetic oligonucleotide primer 24tggatttgaa accacaaata acaacaac 282522DNAArtificialsynthetic oligonucleotide primer 25aaaaggggga catttttcca cg 222623DNAArtificialsynthetic oligonucleotide primer 26cattagggac aacaacagcg ttt 232720DNAArtificialsynthetic oligonucleotide primer 27cgtcgccatc actatgagaa 202821DNAArtificialsynthetic oligonucleotide primer 28aagggatccc tcaactgact g 212922DNAArtificialsynthetic oligonucleotide primer 29ccatcccttc ctccaaatag at 223022DNAArtificialsynthetic oligonucleotide primer 30tgacgaagct tgaggttatt cg 223123DNAArtificialsynthetic oligonucleotide primer 31gccaagaaga taacaagctc ggc 233226DNAArtificialsynthetic oligonucleotide primer 32gggttatatc agtttttctt tttgtt 263321DNAArtificialsynthetic oligonucleotide primer 33agatccaaca cctggcctaa t 213427DNAArtificialsynthetic oligonucleotide primer 34aacaaaacta gcccatagaa acattga 273525DNAArtificialsynthetic oligonucleotide primer 35gaaatgccca gaaaaaccta ataac 253622DNAArtificialsynthetic oligonucleotide primer 36gccgtgaaga cagttgatcg tt 223723DNAArtificialsynthetic oligonucleotide primer 37cagttgattt ttgtttttcg gca 233822DNAArtificialsynthetic oligonucleotide primer 38ttgtccaaac ttgcagggaa ca 223925DNAArtificialsynthetic oligonucleotide primer 39tggatgagtt ctattggggt agtcg 254022DNAArtificialsynthetic oligonucleotide primer 40gacctcgctc tctgtttctc at 224122DNAArtificialsynthetic oligonucleotide primer 41cgcaatccca attcacctct tc 224224DNAArtificialsynthetic oligonucleotide primer 42gaaccccgtt tcaacatttt atga 244322DNAArtificialsynthetic oligonucleotide primer 43ggtcgttaag cccactttga ga 224424DNAArtificialsynthetic oligonucleotide primer 44tgcagctttc actaatcgtc agaa 244523DNAArtificialsynthetic oligonucleotide primer 45gggagtgtga acttacattg tct 234622DNAArtificialsynthetic oligonucleotide primer 46gcgatcatgt ctctgccatc ag 224728DNAArtificialsynthetic oligonucleotide primer 47gaagggatat ggagagtgag aaattaga 284826DNAArtificialsynthetic oligonucleotide primer 48aaaaattgtg taaacgaaag atggga 264922DNAArtificialsynthetic oligonucleotide primer 49tgagcccaac ctccacatct tt 225020DNAArtificialsynthetic oligonucleotide primer 50cactgctttt tcccctctct 205129DNAArtificialsynthetic oligonucleotide primer 51gcggtaaatg gtgaaaatca tttatggtt 295226DNAArtificialsynthetic oligonucleotide primer 52ggaatgcatg agtattaacc tcttat 265328DNAArtificialsynthetic oligonucleotide primer 53tgtcttccca atccatctaa tctaatca 285427DNAArtificialsynthetic oligonucleotide primer 54ccaattatgt ttctatgcca tcttgtt 275526DNAArtificialsynthetic oligonucleotide primer 55tgtggataaa agccatctct aacaaa 265624DNAArtificialsynthetic oligonucleotide primer 56tcgataccaa tcatccaatc caaa 245722DNAArtificialsynthetic oligonucleotide primer 57tccttagacc tctcgcgcaa ac 225820DNAArtificialsynthetic oligonucleotide primer 58tacccttaat caccggacaa 205922DNAArtificialsynthetic oligonucleotide primer 59acgtatgcga aggagggaga tg 226022DNAArtificialsynthetic oligonucleotide primer 60ttggctcttg tgtaagtggc cc 226122DNAArtificialsynthetic oligonucleotide primer 61ttcagtccct tggtggttcc aa 226222DNAArtificialsynthetic oligonucleotide primer 62catggtcctt gggtgcaatt ta 226327DNAArtificialsynthetic oligonucleotide primer 63aaaaatgtgt tagagcttgt gttgtta 276422DNAArtificialsynthetic oligonucleotide primer 64atggtgcagt gttgcaggtt gt 226526DNAArtificialsynthetic oligonucleotide primer 65gaccacaact tcttttttgt gaatgg 266624DNAArtificialsynthetic oligonucleotide primer 66ccgtcaccgt taataaaata gcat 246727DNAArtificialsynthetic oligonucleotide primer 67agaagcatac tcgtcgtaac actatcc 276826DNAArtificialsynthetic oligonucleotide primer 68gagcaggaca ttttttttat ccttga 266922DNAArtificialsynthetic oligonucleotide primer 69tgcttgaggt tgaaggaaat gc 227023DNAArtificialsynthetic oligonucleotide primer 70tccttggggt gaattgtttt tca 237127DNAArtificialsynthetic oligonucleotide primer 71gcgttgatca ggtcgatttt tatttgt 277221DNAArtificialsynthetic oligonucleotide primer 72aatgctttgg tcgttgcatt g 217322DNAArtificialsynthetic oligonucleotide primer 73cagcgtctgc atgatagcgt tt 227428DNAArtificialsynthetic oligonucleotide primer 74tgcaaattgt tattgtgaga ctgaatga 287520DNAArtificialsynthetic oligonucleotide primer 75cgccagctag ctagtctcat 207624DNAArtificialsynthetic oligonucleotide primer 76cctccacccc cttcccaccc aaaa 247722DNAArtificialsynthetic oligonucleotide primer 77agcgtcgtct ggctaggtct gt 227825DNAArtificialsynthetic oligonucleotide primer 78gtcattggtc tcaaacaatc ttcat 257925DNAArtificialsynthetic oligonucleotide primer 79gcgactttct tttcaatttc actcc 258022DNAArtificialsynthetic oligonucleotide primer 80cactttttca ctgtctcccc cc 228123DNAArtificialsynthetic oligonucleotide primer 81tgggccattt gggcagctcg act 238222DNAArtificialsynthetic oligonucleotide primer 82gcgccccatt aatgttaaca ca 228327DNAArtificialsynthetic oligonucleotide primer 83ggagagaatc catatatatt gaattgc 278423DNAArtificialsynthetic oligonucleotide primer 84ccttttgaca attatggcat ata 238522DNAArtificialsynthetic oligonucleotide primer 85cctgtcaaat tggctgatgc aa 228627DNAArtificialsynthetic oligonucleotide primer 86ttttaccaaa caaattaaac tgcgtct 278720DNAArtificialsynthetic oligonucleotide primer 87ccggtctgac ctattctcat 208823DNAArtificialsynthetic oligonucleotide primer 88ggtgtttcaa gtttcaacac cat 238923DNAArtificialsynthetic oligonucleotide primer 89atgacaagga aaaatcaatc aac 239026DNAArtificialsynthetic oligonucleotide primer 90gcggggtcaa ttagttttcg tcagtt 269124DNAArtificialsynthetic oligonucleotide primer 91gcgcaaaagg acgcccacca atag 249223DNAArtificialsynthetic oligonucleotide primer 92tctgcttatt cattgtgtgc gtg 239323DNAArtificialsynthetic oligonucleotide primer 93tggtatatgt ttttgcggga caa 239422DNAArtificialsynthetic oligonucleotide primer 94aggtgggcta ggagtgacca ca 229527DNAArtificialsynthetic oligonucleotide primer 95gcgacatatt gcattaaaaa catactt 279623DNAArtificialsynthetic oligonucleotide primer 96ggggtgaatg aatgtcaaga tga 239724DNAArtificialsynthetic oligonucleotide primer 97gcggaattag aactccagta aaga 249827DNAArtificialsynthetic oligonucleotide primer 98ttagtggatc tacactaaac taatccg 279922DNAArtificialsynthetic oligonucleotide primer 99aggcatttct ggcaagggta tg 2210023DNAArtificialsynthetic oligonucleotide primer 100gcgcccacac aacctttaat ctt 2310122DNAArtificialsynthetic oligonucleotide primer 101atgggctatg ggaggaggtg tt 2210223DNAArtificialsynthetic oligonucleotide primer 102ccagtgcagt tttacatgaa ctt 2310323DNAArtificialsynthetic oligonucleotide primer 103gctggccttt agaacgtctg act 2310424DNAArtificialsynthetic oligonucleotide primer 104ccacaaaaag atgaaacaaa atag 2410524DNAArtificialsynthetic oligonucleotide primer 105gcggagattg gaacctactc attc 2410622DNAArtificialsynthetic oligonucleotide primer 106aacaatttga tggtcggggt tg 2210723DNAArtificialsynthetic oligonucleotide primer 107caccgtcgta aaaactgtgt cgt 2310824DNAArtificialsynthetic oligonucleotide primer 108gaagtgctag ttctcacggt gtgg 2410924DNAArtificialsynthetic oligonucleotide primer 109ttcgctgcat aatttttagc atca 2411027DNAArtificialsynthetic oligonucleotide primer 110aaagagacac ccaaaagata acaaaca 2711119DNAArtificialsynthetic oligonucleotide primer 111tgaccaccat gagttcatt 1911224DNAArtificialsynthetic oligonucleotide primer 112gcgggacgca aaattggatt tagt 2411322DNAArtificialsynthetic oligonucleotide primer 113gtgaccctcc attccacaac aa 2211422DNAArtificialsynthetic oligonucleotide primer 114gcagagtccc ccctaaatat ag 2211520DNAArtificialsynthetic oligonucleotide primer 115gtgaatcatc cagggcttgc 2011624DNAArtificialsynthetic oligonucleotide primer 116gcgaatggtt tttgctggaa agta 2411727DNAArtificialsynthetic oligonucleotide primer 117gcgttaagaa tgcatttatg tttagtc 2711820DNAArtificialsynthetic oligonucleotide primer 118caagctcaag cctcacacat 2011918DNAArtificialsynthetic oligonucleotide primer 119aattggagtg ggtcacac 1812027DNAArtificialsynthetic oligonucleotide primer 120gcgcccaagt attatgagat atttgat 2712127DNAArtificialsynthetic oligonucleotide primer 121ctttgtttgg ttggtgataa gtttcta 2712222DNAArtificialsynthetic oligonucleotide primer 122aattgttagg gcgcgagaaa ca 2212322DNAArtificialsynthetic oligonucleotide primer 123gttcggaggg aggaaagtgt tg 2212424DNAArtificialsynthetic oligonucleotide primer 124tgttcaatcg acaaataagg gtgc 2412525DNAArtificialsynthetic oligonucleotide primer 125ctttacttag taatggttcc cacag 2512629DNAArtificialsynthetic oligonucleotide primer 126ccagatttta

cgttaatgtt ttagtttta 2912724DNAArtificialsynthetic oligonucleotide primer 127catacacgca ttgcctttcc tgaa 2412824DNAArtificialsynthetic oligonucleotide primer 128gcgtcccagg acatcatcat catc 2412923DNAArtificialsynthetic oligonucleotide primer 129tgctgcttgt gtttggttga tct 2313022DNAArtificialsynthetic oligonucleotide primer 130aatccccaaa caaacgcaca gt 2213127DNAArtificialsynthetic oligonucleotide primer 131gcggcgcttt atgtaacaat acgattt 2713223DNAArtificialsynthetic oligonucleotide primer 132gcgagaaaat aatcctgctc aag 2313322DNAArtificialsynthetic oligonucleotide primer 133tcgggagaca ctaaaggcac tg 2213423DNAArtificialsynthetic oligonucleotide primer 134gcggcataag ttttcatccc atc 2313525DNAArtificialsynthetic oligonucleotide primer 135gcggatatgc cacttctctc gtgac 2513625DNAArtificialsynthetic oligonucleotide primer 136ggagaaaaac atccaaagaa atgtg 2513729DNAArtificialsynthetic oligonucleotide primer 137ggataatttt ttcatcatca caatttatc 2913827DNAArtificialsynthetic oligonucleotide primer 138tggaaatact gaatgaaagc atattgg 2713925DNAArtificialsynthetic oligonucleotide primer 139ccattgggat cgagaataat tgatg 2514022DNAArtificialsynthetic oligonucleotide primer 140agagtaatgg ctcctgctcc ga 2214126DNAArtificialsynthetic oligonucleotide primer 141cgatctaaca cgcatatttc ctctga 2614223DNAArtificialsynthetic oligonucleotide primer 142tgggggtcaa ttttaatttg tgc 2314326DNAArtificialsynthetic oligonucleotide primer 143gattctcttc attctaatac tcgttt 2614428DNAArtificialsynthetic oligonucleotide primer 144gcgttacgtt tcactattta tttaacat 2814527DNAArtificialsynthetic oligonucleotide primer 145gctggtgtat ggtgaaatca aattact 2714627DNAArtificialsynthetic oligonucleotide primer 146tgatattgtt ttgtgtgaaa gatgcac 2714724DNAArtificialsynthetic oligonucleotide primer 147tgctcaaagg gtcaatttct ttcc 2414825DNAArtificialsynthetic oligonucleotide primer 148ccaagcccat aaacgaaata aaaca 2514925DNAArtificialsynthetic oligonucleotide primer 149cagtgctcat atcaaattaa agtgg 2515022DNAArtificialsynthetic oligonucleotide primer 150tttcaaccac caagccaacc tt 2215123DNAArtificialsynthetic oligonucleotide primer 151tgcagcatgt gttttaggct ttc 2315227DNAArtificialsynthetic oligonucleotide primer 152ccttagacca tgaatgtctc gaagata 2715324DNAArtificialsynthetic oligonucleotide primer 153tggccatgtc aaaccataac aaca 2415422DNAArtificialsynthetic oligonucleotide primer 154actggcgctg accttaaatt gc 2215528DNAArtificialsynthetic oligonucleotide primer 155tgtttttaag taatccggtg aaatagca 2815626DNAArtificialsynthetic oligonucleotide primer 156tcacatcaca agtttcataa atgctg 2615722DNAArtificialsynthetic oligonucleotide primer 157gcgtctccct taatcttcaa gc 2215825DNAArtificialsynthetic oligonucleotide primer 158agattaagag aagacgagag tttta 2515922DNAArtificialsynthetic oligonucleotide primer 159gccaggtgct cacttcttgc ta 2216026DNAArtificialsynthetic oligonucleotide primer 160caggagaaaa aaggaaaaga aaagca 2616126DNAArtificialsynthetic oligonucleotide primer 161aggttttgct tcttgaaagt gaagag 2616224DNAArtificialsynthetic oligonucleotide primer 162gtctccgttc aaagcttctt cttc 2416322DNAArtificialsynthetic oligonucleotide primer 163gaggggaggt aaaaagtcgg ga 2216423DNAArtificialsynthetic oligonucleotide primer 164cgcttgggtt cagttacttg gtg 2316528DNAArtificialsynthetic oligonucleotide primer 165gcgcccatta ttattttcct tgaattgt 2816628DNAArtificialsynthetic oligonucleotide primer 166gcgaccatca tctaatcaca atctacta 2816723DNAArtificialsynthetic oligonucleotide primer 167aatgcaagaa gcaatcagca aga 2316826DNAArtificialsynthetic oligonucleotide primer 168tggcaccctt gataaataag agaagg 2616922DNAArtificialsynthetic oligonucleotide primer 169aattgaacca ctcagccaag cc 2217026DNAArtificialsynthetic oligonucleotide primer 170gtctaagatt ttaattaggg tgattc 2617127DNAArtificialsynthetic oligonucleotide primer 171gcgtataaag aaaaacgagc atatcat 2717227DNAArtificialsynthetic oligonucleotide primer 172caaattgaaa aacacaagaa aacacaa 2717325DNAArtificialsynthetic oligonucleotide primer 173agcaactaac cttgggcttc agtaa 2517422DNAArtificialsynthetic oligonucleotide primer 174cctggacttg tttgctcatc aa 2217523DNAArtificialsynthetic oligonucleotide primer 175aattcctttg gcatttttgt tgc 2317624DNAArtificialsynthetic oligonucleotide primer 176tttcactttt gaatcattgc atcg 2417725DNAArtificialsynthetic oligonucleotide primer 177caccactcgt atccttcaca agagc 2517826DNAArtificialsynthetic oligonucleotide primer 178gcgcaattaa aaggataact tatatc 2617922DNAArtificialsynthetic oligonucleotide primer 179aaaattcatg tcgctgcgtt ca 2218025DNAArtificialsynthetic oligonucleotide primer 180tgaaaaccat gtcaaagtaa tggca 2518123DNAArtificialsynthetic oligonucleotide primer 181ggaaagtttt gttacatgcc gga 2318224DNAArtificialsynthetic oligonucleotide primer 182ttttaactgg agaaacctga ggga 2418324DNAArtificialsynthetic oligonucleotide primer 183gcgcgatggg ctgttggttt ttat 2418422DNAArtificialsynthetic oligonucleotide primer 184ttgcttgctg cacatgactg ag 2218522DNAArtificialsynthetic oligonucleotide primer 185ttgaaatagt ggtggggttg gg 2218622DNAArtificialsynthetic oligonucleotide primer 186tgtgttgtgt ggtgtggtgg tc 2218723DNAArtificialsynthetic oligonucleotide primer 187caaagtcccc tttcacacct ttt 2318824DNAArtificialsynthetic oligonucleotide primer 188aaagggaaag gaagaataaa ccga 2418922DNAArtificialsynthetic oligonucleotide primer 189tgctttttct ctttggcaac cc 2219026DNAArtificialsynthetic oligonucleotide primer 190gcgcccaaaa ctatctagta attctt 2619123DNAArtificialsynthetic oligonucleotide primer 191ccaacaacca aatcaatcac tgc 2319222DNAArtificialsynthetic oligonucleotide primer 192gctccggtcc ttcaactgac ct 2219322DNAArtificialsynthetic oligonucleotide primer 193atgtgggtat gttgcaggca ga 2219425DNAArtificialsynthetic oligonucleotide primer 194gttgggaaaa ggttactacc atatc 2519524DNAArtificialsynthetic oligonucleotide primer 195cagccaagca aaagataaat aata 2419629DNAArtificialsynthetic oligonucleotide primer 196gcgctttcaa aaagtaacaa ttaatgaaa 2919722DNAArtificialsynthetic oligonucleotide primer 197gacctttcat catcgtcccc ac 2219823DNAArtificialsynthetic oligonucleotide primer 198tcaattcatc acggaccagt tca 2319922DNAArtificialsynthetic oligonucleotide primer 199gtgagtttcg gtgctgtatt cc 2220024DNAArtificialsynthetic oligonucleotide primer 200cctaaattga tgaaaggata caag 2420121DNAArtificialsynthetic oligonucleotide primer 201gtatcgttcg cgtcttgagt c 2120226DNAArtificialsynthetic oligonucleotide primer 202ttaacgggaa aaaattaaac ctacga 2620325DNAArtificialsynthetic oligonucleotide primer 203tggagattta atatagatgc cgcga 2520424DNAArtificialsynthetic oligonucleotide primer 204gcggttttgg attgactttg ttga 2420526DNAArtificialsynthetic oligonucleotide primer 205ccgtgacttt tgttatcctg agttcc 2620622DNAArtificialsynthetic oligonucleotide primer 206gcgaattggc atacatagta cc 2220722DNAArtificialsynthetic oligonucleotide primer 207tgcaccacta atgtcctcag cc 2220822DNAArtificialsynthetic oligonucleotide primer 208gcaatgggta ttgatcgtgt ca 2220927DNAArtificialsynthetic oligonucleotide primer 209gcgctaccgt gtggtggtgt gctacct 2721028DNAArtificialsynthetic oligonucleotide primer 210gcgagtttcg ccgttaccac ctcagctt 2821124DNAArtificialsynthetic oligonucleotide primer 211tgcgacttta ctgaaaacct ggaa 2421225DNAArtificialsynthetic oligonucleotide primer 212aacgtcttca agtcaagtgc ctaca 2521327DNAArtificialsynthetic oligonucleotide primer 213gcgcatcaca agttttatag atgctga 2721429DNAArtificialsynthetic oligonucleotide primer 214gggtacattt tattaaaagt aaacacacc 2921528DNAArtificialsynthetic oligonucleotide primer 215tgaaccttgt ctgttgattt ttttatgt 2821626DNAArtificialsynthetic oligonucleotide primer 216tctcctactt ctctttctcc cgttca 2621725DNAArtificialsynthetic oligonucleotide primer 217cctgattata tgtctagaca aacat 2521826DNAArtificialsynthetic oligonucleotide primer 218gagatcacat caaagtcaaa actgcc 2621927DNAArtificialsynthetic oligonucleotide primer 219gcgatttctt ccttgaagaa ttttctg 2722027DNAArtificialsynthetic oligonucleotide primer 220gcgaattatc caaagataca cttagtc 2722122DNAArtificialsynthetic oligonucleotide primer 221atatcgaaaa tcgcgcatct gg 2222225DNAArtificialsynthetic oligonucleotide primer 222gcgcattaag gcataaaaaa ggata 2522325DNAArtificialsynthetic oligonucleotide primer 223gcgccaatat tatcatgctt tatgt 2522425DNAArtificialsynthetic oligonucleotide primer 224agtggtcgtc acaacactat catat 2522522DNAArtificialsynthetic oligonucleotide primer 225ctcctcctgc gcaacaacaa ta 2222622DNAArtificialsynthetic oligonucleotide primer 226gcgtggaatg agacgtaacc aa 2222726DNAArtificialsynthetic oligonucleotide primer 227caaaacttat gtgcaacacg acttca 2622823DNAArtificialsynthetic oligonucleotide primer 228aatgtagcaa tttgactggc gaa 2322924DNAArtificialsynthetic oligonucleotide primer 229gcggatctaa ggataattca ttaa 2423021DNAArtificialsynthetic oligonucleotide primer 230gctatgggaa aaggatgtgt g 2123122DNAArtificialsynthetic oligonucleotide primer 231atgtgatggc atgtgaaatg gt 2223226DNAArtificialsynthetic oligonucleotide primer 232cagggtatag ttcaattcag tgagcg 2623325DNAArtificialsynthetic oligonucleotide primer 233cctctttgtt ggtggttaag tctcc 2523425DNAArtificialsynthetic oligonucleotide primer 234gcggcaaaac tttggagtat tgcaa 2523525DNAArtificialsynthetic oligonucleotide primer 235tcgtcaatta agcaaaaatg tgaga 2523622DNAArtificialsynthetic oligonucleotide primer 236gaatatcacg cgagaatttt ac 2223722DNAArtificialsynthetic oligonucleotide primer 237acaaaaagaa atcgaaccgg ca 2223824DNAArtificialsynthetic oligonucleotide primer 238tggctttgat gatgtttgag acaa 2423925DNAArtificialsynthetic oligonucleotide primer 239cccagataca gacaataaaa cccga 2524026DNAArtificialsynthetic oligonucleotide primer 240tccaccatgt aatatgtgaa gtggat 2624121DNAArtificialsynthetic oligonucleotide primer 241ctcacaccct ttcattatct a 2124225DNAArtificialsynthetic oligonucleotide primer 242actctatttt attatcgtgc aagaa 2524321DNAArtificialsynthetic oligonucleotide primer 243gatgacaacg taggctaaaa a 2124423DNAArtificialsynthetic oligonucleotide primer 244gattctatat ccatcgtgtt gct 2324523DNAArtificialsynthetic oligonucleotide primer 245cccactgtat ccttagtgtg cca 2324618DNAArtificialsynthetic oligonucleotide primer 246ggctaacccg ctctatgt 1824725DNAArtificialsynthetic oligonucleotide primer 247cattaactaa taagttgttg gtagc 2524821DNAArtificialsynthetic oligonucleotide primer 248accaaattgc ttcacgcatc c 2124922DNAArtificialsynthetic oligonucleotide primer 249tgctcatgtg gtcctaccca ga 2225027DNAArtificialsynthetic oligonucleotide primer 250gcggagcatg taaatccagc ctattga 2725126DNAArtificialsynthetic oligonucleotide primer 251gcggatttcg atttgaatat acttac

2625225DNAArtificialsynthetic oligonucleotide primer 252tggacacaca caaacaccta cagaa 2525323DNAArtificialsynthetic oligonucleotide primer 253agcaagtctt gagtcttttg tct 2325422DNAArtificialsynthetic oligonucleotide primer 254tcccacgtca tatccactgc tc 2225523DNAArtificialsynthetic oligonucleotide primer 255ccaaagctga gcagctgata act 2325625DNAArtificialsynthetic oligonucleotide primer 256ccggtgatac tccataccaa taaca 2525724DNAArtificialsynthetic oligonucleotide primer 257ccgagctaac aaaggcgacc aaat 2425827DNAArtificialsynthetic oligonucleotide primer 258gcgcccaaac ctattaaggt atgaaca 2725922DNAArtificialsynthetic oligonucleotide primer 259atggccgtct caaaagaact gg 2226022DNAArtificialsynthetic oligonucleotide primer 260gcgaatggtt gctcaaataa tc 2226126DNAArtificialsynthetic oligonucleotide primer 261gcgcgcattt tttaagttaa tgttct 2626222DNAArtificialsynthetic oligonucleotide primer 262ggcagactcg tagagcaatt ta 2226327DNAArtificialsynthetic oligonucleotide primer 263gcgaagattg gtcttttatg tcaaatg 2726427DNAArtificialsynthetic oligonucleotide primer 264gcggtaactc ctcgagtccc tctcaat 2726522DNAArtificialsynthetic oligonucleotide primer 265tggtgatggg aagcaaacaa ga 2226622DNAArtificialsynthetic oligonucleotide primer 266ccatcccttc gtccaccaaa ta 2226727DNAArtificialsynthetic oligonucleotide primer 267tgctgcagcg tgtctgtagt ataattt 2726826DNAArtificialsynthetic oligonucleotide primer 268cgatttgaat atacttaccg tctata 2626926DNAArtificialsynthetic oligonucleotide primer 269gtaacattgg ttgtcatctt tgtcta 2627026DNAArtificialsynthetic oligonucleotide primer 270ggaggttatc tagtggtata gatggt 2627122DNAArtificialsynthetic oligonucleotide primer 271ccaaaagcat tgagagtggg ga 2227222DNAArtificialsynthetic oligonucleotide primer 272gaaacccgaa acgcaaaatc tc 2227322DNAArtificialsynthetic oligonucleotide primer 273ctctcgccgg tacaaaacac ct 2227428DNAArtificialsynthetic oligonucleotide primer 274tcactctcac aacttcaatc tctttctc 2827522DNAArtificialsynthetic oligonucleotide primer 275cacgactctt cctcttcctc cg 2227616DNAArtificialsynthetic oligonucleotide primer 276ccctgtgttt ccctct 1627722DNAArtificialsynthetic oligonucleotide primer 277gtgttgctct tgggaatctg gc 2227817DNAArtificialsynthetic oligonucleotide primer 278tctcgactca cgactca 1727928DNAArtificialsynthetic oligonucleotide primer 279aaaatgaaaa cacacagaga gagagaga 2828022DNAArtificialsynthetic oligonucleotide primer 280agcgaaatgt gtggtccaag gt 2228122DNAArtificialsynthetic oligonucleotide primer 281cgtcgagaaa ggaagagagg ca 2228222DNAArtificialsynthetic oligonucleotide primer 282gcggaaacca ttctgacgga ta 2228323DNAArtificialsynthetic oligonucleotide primer 283ggaggaactt ggaaggcata tca 2328421DNAArtificialsynthetic oligonucleotide primer 284acggacaacg ctggcactaa g 2128520DNAArtificialsynthetic oligonucleotide primer 285caaaaggttt tcagtggtgg 2028622DNAArtificialsynthetic oligonucleotide primer 286ccaatcccta ccctgattgc ac 2228722DNAArtificialsynthetic oligonucleotide primer 287ggaagtggat ttggagttgg ga 2228822DNAArtificialsynthetic oligonucleotide primer 288aacccataac ctgctcgtct ca 2228922DNAArtificialsynthetic oligonucleotide primer 289aggcgggttt ggagctgttt ac 2229025DNAArtificialsynthetic oligonucleotide primer 290tcttctcagg aacttgaatt actca 2529122DNAArtificialsynthetic oligonucleotide primer 291ggaatgtccc aagtgtcagc aa 2229228DNAArtificialsynthetic oligonucleotide primer 292tgaaaataag tggaaagaaa aaggaaaa 2829322DNAArtificialsynthetic oligonucleotide primer 293gtccccgttc ctcaaacacc tt 2229424DNAArtificialsynthetic oligonucleotide primer 294tgcacactca cttggtctta caca 2429522DNAArtificialsynthetic oligonucleotide primer 295ctgttggaaa atgatgcgtg gc 2229621DNAArtificialsynthetic oligonucleotide primer 296ttgatcactt ctgtaacatt c 2129722DNAArtificialsynthetic oligonucleotide primer 297ctttgttgtt tggtcaaggc cc 2229825DNAArtificialsynthetic oligonucleotide primer 298tgccgaaata agtgagagca tagaa 2529927DNAArtificialsynthetic oligonucleotide primer 299tgttaggtat gggatttagg gttttga 2730025DNAArtificialsynthetic oligonucleotide primer 300tccactcact gtatgtcttc ccttg 2530123DNAArtificialsynthetic oligonucleotide primer 301ttgagtgctc ttggtgtttt cct 2330226DNAArtificialsynthetic oligonucleotide primer 302ccaaacaccc cagtataaaa aatgga 2630322DNAArtificialsynthetic oligonucleotide primer 303ggattttgag ttgctccaag gc 2230424DNAArtificialsynthetic oligonucleotide primer 304tgtatgatcc atcctctgaa accg 2430524DNAArtificialsynthetic oligonucleotide primer 305tcacatgttc gggacttaag gtat 2430625DNAArtificialsynthetic oligonucleotide primer 306tgaatggcta aaaacgtgat ttgga 2530722DNAArtificialsynthetic oligonucleotide primer 307ggaccttccc tttcccatga ct 2230822DNAArtificialsynthetic oligonucleotide primer 308agcgatggtt gaagaaaggg tc 2230922DNAArtificialsynthetic oligonucleotide primer 309agagaacggg cgatttatgg ct 2231022DNAArtificialsynthetic oligonucleotide primer 310atgtcgccac taggccaatc ag 2231124DNAArtificialsynthetic oligonucleotide primer 311ccatcttgag cagagtttga agtt 2431225DNAArtificialsynthetic oligonucleotide primer 312gtggtggtgg tgaaaactat tagaa 2531325DNAArtificialsynthetic oligonucleotide primer 313cttccacacc ctagtttagt gacaa 2531422DNAArtificialsynthetic oligonucleotide primer 314tcaagcttat gctctatagg ct 2231524DNAArtificialsynthetic oligonucleotide primer 315gaccaaaatt caaggcagtg acaa 2431620DNAArtificialsynthetic oligonucleotide primer 316ccatcctcgt tagcatctat 2031721DNAArtificialsynthetic oligonucleotide primer 317gctgcacaat tcattccatt t 2131825DNAArtificialsynthetic oligonucleotide primer 318cccagggact tacttttttc agttt 2531926DNAArtificialsynthetic oligonucleotide primer 319tgaagcaaca aaatagagga atagag 2632025DNAArtificialsynthetic oligonucleotide primer 320cattactagg cgtgtgttgt ttcaa 2532122DNAArtificialsynthetic oligonucleotide primer 321cacgcgcatc agctttgtag ag 2232224DNAArtificialsynthetic oligonucleotide primer 322tcttttcacc attctccaac ctca 2432323DNAArtificialsynthetic oligonucleotide primer 323tcctttctcc catttttttt ggg 2332422DNAArtificialsynthetic oligonucleotide primer 324ggtgaccacc cctattcctt at 2232522DNAArtificialsynthetic oligonucleotide primer 325aattgttagg gcgcgagaaa ca 2232622DNAArtificialsynthetic oligonucleotide primer 326ctagccaagg gagagaggag ca 2232722DNAArtificialsynthetic oligonucleotide primer 327cctcacacca accagcacaa aa 2232827DNAArtificialsynthetic oligonucleotide primer 328caattttatg atttgctttt gaaggga 2732921DNAArtificialsynthetic oligonucleotide primer 329gggccttgaa ttttgtgcta t 2133022DNAArtificialsynthetic oligonucleotide primer 330cctcttgaaa ccgtgaaacc gt 2233124DNAArtificialsynthetic oligonucleotide primer 331tctttttctt catttttgtt cgca 2433223DNAArtificialsynthetic oligonucleotide primer 332aaactgctct gaagtgcgac aca 2333325DNAArtificialsynthetic oligonucleotide primer 333tgtgaataaa agaaatcccc attga 2533425DNAArtificialsynthetic oligonucleotide primer 334aagatacccc caacattatt tgtaa 2533526DNAArtificialsynthetic oligonucleotide primer 335gcgttttcat acggtgtttt gcctat 2633627DNAArtificialsynthetic oligonucleotide primer 336gggctaacga acatgtaact tatcaac 2733728DNAArtificialsynthetic oligonucleotide primer 337gcactacaat atgtgcatga atttttct 2833823DNAArtificialsynthetic oligonucleotide primer 338tctccttact cactccattg gca 2333922DNAArtificialsynthetic oligonucleotide primer 339tccatgtcac caaccacaaa aa 2234022DNAArtificialsynthetic oligonucleotide primer 340cgtatccctt tcccatacgt gg 2234122DNAArtificialsynthetic oligonucleotide primer 341atgacgggat gaaagagcca aa 2234225DNAArtificialsynthetic oligonucleotide primer 342agggaactaa cacatttaat catca 2534326DNAArtificialsynthetic oligonucleotide primer 343cggaaaagat ataccgagtg agaaaa 2634424DNAArtificialsynthetic oligonucleotide primer 344ttctaaggat ttgtggtaat cggc 2434523DNAArtificialsynthetic oligonucleotide primer 345catggagaaa agaagaggag gga 2334625DNAArtificialsynthetic oligonucleotide primer 346aagcaaacca ttatcttcat tggtg 2534722DNAArtificialsynthetic oligonucleotide primer 347gccacactat tccagccact ac 2234822DNAArtificialsynthetic oligonucleotide primer 348agtagtccaa accgaaacgc ca 2234922DNAArtificialsynthetic oligonucleotide primer 349tcaattcggt caaaaggctt ga 2235024DNAArtificialsynthetic oligonucleotide primer 350ctcccccaaa tttaacctta aaga 2435123DNAArtificialsynthetic oligonucleotide primer 351aatggatgga cctgtcagtc tgc 2335225DNAArtificialsynthetic oligonucleotide primer 352tgcttccatt agtctctcat cctcc 2535326DNAArtificialsynthetic oligonucleotide primer 353tggaaaaaga taacgtgtgt ttgcag 2635422DNAArtificialsynthetic oligonucleotide primer 354ccttcttttg acatggggcc ta 2235527DNAArtificialsynthetic oligonucleotide primer 355gcgagtgcca actaactact tttatga 2735623DNAArtificialsynthetic oligonucleotide primer 356tggtatcggg agattttttc agc 2335728DNAArtificialsynthetic oligonucleotide primer 357tttttcgtca gcacattatt acacattt 2835823DNAArtificialsynthetic oligonucleotide primer 358ggccagtgtt gagggattta gaa 2335924DNAArtificialsynthetic oligonucleotide primer 359aatttgctcc agtgttttaa gttt 2436021DNAArtificialsynthetic oligonucleotide primer 360ggtgatatcg cgctaaaatt a 2136122DNAArtificialsynthetic oligonucleotide primer 361ggaaaccctg tcattttcgt gc 2236222DNAArtificialsynthetic oligonucleotide primer 362agagttctca gtccgccagc tc 2236321DNAArtificialsynthetic oligonucleotide primer 363gcgcaattgt caccaacaca t 2136422DNAArtificialsynthetic oligonucleotide primer 364cccaaaccaa caagcaacaa ca 2236523DNAArtificialsynthetic oligonucleotide primer 365attcacacgc atctggaata ata 2336623DNAArtificialsynthetic oligonucleotide primer 366gcggagttca acgcattcac ctt 2336723DNAArtificialsynthetic oligonucleotide primer 367tgaaagcaaa cgagactcat gga 2336823DNAArtificialsynthetic oligonucleotide primer 368gcatagaagg gcatcattca gat 2336925DNAArtificialsynthetic oligonucleotide primer 369gctagatgag cagaccattg cactt 2537027DNAArtificialsynthetic oligonucleotide primer 370caagaggttg ttgtaagagt gatctcg 2737120DNAArtificialsynthetic oligonucleotide primer 371cacggcgtat ttttattttg 2037224DNAArtificialsynthetic oligonucleotide primer 372cagtgcatgg ttttctcatg tacc 2437320DNAArtificialsynthetic oligonucleotide primer 373gctgctgtta agagtgtttg 2037425DNAArtificialsynthetic oligonucleotide primer 374gcgcacggta tataatcgaa cctat 2537526DNAArtificialsynthetic oligonucleotide primer 375gcggtgatcg gatgttatag tttcag 2637624DNAArtificialsynthetic oligonucleotide primer 376tgtctccatg ctgtaacacg tcaa 2437722DNAArtificialsynthetic oligonucleotide primer 377cgccaaagat

gcaacacact tg 2237826DNAArtificialsynthetic oligonucleotide primer 378tgtaattgct gttttggttt catttc 2637929DNAArtificialsynthetic oligonucleotide primer 379gcggactaat tctattttac accaacaac 2938024DNAArtificialsynthetic oligonucleotide primer 380gcgcgaggta tcaacacaat tact 2438121DNAArtificialsynthetic oligonucleotide primer 381gcgaggccaa cattgaaaag t 2138228DNAArtificialsynthetic oligonucleotide primer 382cgtaccattg gacaactctg taattcaa 2838325DNAArtificialsynthetic oligonucleotide primer 383tggtgaatca atctcctcta agtgc 2538420DNAArtificialsynthetic oligonucleotide primer 384gcggcgactg ttaacgtgtc 2038522DNAArtificialsynthetic oligonucleotide primer 385ccacacggga ctttccattt tc 2238623DNAArtificialsynthetic oligonucleotide primer 386tatatgtaat gacccccatc atg 2338722DNAArtificialsynthetic oligonucleotide primer 387cgttggattc gactttttgg ga 2238823DNAArtificialsynthetic oligonucleotide primer 388ttgaagctca ggctgtgatg aat 2338921DNAArtificialsynthetic oligonucleotide primer 389gcggggacca aaaattcaaa a 2139022DNAArtificialsynthetic oligonucleotide primer 390taggggaacc gatttggtga aa 2239124DNAArtificialsynthetic oligonucleotide primer 391gcgtgtcaaa gagttttaga catc 2439222DNAArtificialsynthetic oligonucleotide primer 392ttggagggag gttttggaag gt 2239327DNAArtificialsynthetic oligonucleotide primer 393ccaatctttt tgttagttca ccttcca 2739424DNAArtificialsynthetic oligonucleotide primer 394ttcgtagcaa tgtcaccacc ttgt 2439519DNAArtificialsynthetic oligonucleotide primer 395gggggtggct tttagattc 1939624DNAArtificialsynthetic oligonucleotide primer 396gcgccgaata aaacgtgaga actg 2439723DNAArtificialsynthetic oligonucleotide primer 397tccttgcctt ttagttgttc ggt 2339823DNAArtificialsynthetic oligonucleotide primer 398cgggaacaac cacactctcc att 2339926DNAArtificialsynthetic oligonucleotide primer 399tccttcactt tcaaaaacaa aaacaa 2640024DNAArtificialsynthetic oligonucleotide primer 400gcgcaacgac attttcacga agtt 2440125DNAArtificialsynthetic oligonucleotide primer 401gcgagttttt ggttggattg agttg 2540222DNAArtificialsynthetic oligonucleotide primer 402tgaccagagt ccaaagttca tc 2240318DNAArtificialsynthetic oligonucleotide primer 403ttcccggaaa gaaagaaa 1840423DNAArtificialsynthetic oligonucleotide primer 404gcgataattt taaaactgga cca 2340525DNAArtificialsynthetic oligonucleotide primer 405aagcagttcc tctcatcacg taaca 2540622DNAArtificialsynthetic oligonucleotide primer 406cgcaatccca attcacctct tc 2240726DNAArtificialsynthetic oligonucleotide primer 407ccataaaaca tagcaactgt cgtctc 2640824DNAArtificialsynthetic oligonucleotide primer 408tcccagggta aaagttcaag ttca 2440923DNAArtificialsynthetic oligonucleotide primer 409tcgatgtttc tccctccctt aga 2341022DNAArtificialsynthetic oligonucleotide primer 410ttgcacatgg tccttggttg at 2241126DNAArtificialsynthetic oligonucleotide primer 411gcgaatggga atgccttctt attcta 2641224DNAArtificialsynthetic oligonucleotide primer 412gcgtagcgtg ttattttgtg tttg 2441322DNAArtificialsynthetic oligonucleotide primer 413catatcctgc ccccccaatt at 2241427DNAArtificialsynthetic oligonucleotide primer 414tgacatctaa gtccagaaat caaagca 2741525DNAArtificialsynthetic oligonucleotide primer 415gcgagtaaaa gcagagtgcg gagta 2541627DNAArtificialsynthetic oligonucleotide primer 416gcgtttaagt ccaataacaa agataac 2741723DNAArtificialsynthetic oligonucleotide primer 417tcgttgacac acaaaaaaag cga 2341822DNAArtificialsynthetic oligonucleotide primer 418atcgggtcat gacttttgaa ga 2241925DNAArtificialsynthetic oligonucleotide primer 419gcggaatagt tgccaaacaa taatc 2542027DNAArtificialsynthetic oligonucleotide primer 420caagtggatt gacacactaa ggtttga 2742125DNAArtificialsynthetic oligonucleotide primer 421cacaaaagac aggagatgtg agcaa 2542225DNAArtificialsynthetic oligonucleotide primer 422ttgtagacga cttgtggttc gattc 2542327DNAArtificialsynthetic oligonucleotide primer 423aatgaagaaa atgtgaattt gaaacca 2742427DNAArtificialsynthetic oligonucleotide primer 424ttcccttttt ctaactctcc tttttca 2742525DNAArtificialsynthetic oligonucleotide primer 425tgtcttggtg caatacctga cattt 2542625DNAArtificialsynthetic oligonucleotide primer 426atttcccttt cacccacctc tgttt 2542722DNAArtificialsynthetic oligonucleotide primer 427caacgatccc agctcacagt tt 2242824DNAArtificialsynthetic oligonucleotide primer 428gcggcaggct agctacatca agag 2442927DNAArtificialsynthetic oligonucleotide primer 429tttcaaacaa ggaagaaacc tcttttt 2743022DNAArtificialsynthetic oligonucleotide primer 430aagtaacact gtggcggcat cc 2243128DNAArtificialsynthetic oligonucleotide primer 431tgtgtaattt ctatcacctt attgtgcc 2843222DNAArtificialsynthetic oligonucleotide primer 432tcctttggct cggcctatgt aa 2243322DNAArtificialsynthetic oligonucleotide primer 433cgcggactca gttaaaccgt at 2243426DNAArtificialsynthetic oligonucleotide primer 434cgttcaatag ttcctatgat ggacga 2643522DNAArtificialsynthetic oligonucleotide primer 435gcattgcacg tcgattttag gg 2243626DNAArtificialsynthetic oligonucleotide primer 436cttaaggaca cgtggaagat gactac 2643726DNAArtificialsynthetic oligonucleotide primer 437gcgttgaagc cgcctacaaa tataat 2643828DNAArtificialsynthetic oligonucleotide primer 438tccttttaat tctaacattg agacagca 2843927DNAArtificialsynthetic oligonucleotide primer 439tctgtcccaa aaaagaaaga agatatg 2744027DNAArtificialsynthetic oligonucleotide primer 440caatctttaa tgctctggag tttgaga 2744126DNAArtificialsynthetic oligonucleotide primer 441gcgtgtgacg gttcaaaatg atagtt 2644225DNAArtificialsynthetic oligonucleotide primer 442gggtaattta tctgtgtgat tgttc 2544328DNAArtificialsynthetic oligonucleotide primer 443ttgcttggga ttttcatttt attatagg 2844425DNAArtificialsynthetic oligonucleotide primer 444ggtcaaagaa taagggattt gcctc 2544525DNAArtificialsynthetic oligonucleotide primer 445tgggactttg atttttggaa taccc 2544624DNAArtificialsynthetic oligonucleotide primer 446ccagagaaat tattggagtg gcaa 2444722DNAArtificialsynthetic oligonucleotide primer 447gcgcaaagaa attcccatcc ta 2244822DNAArtificialsynthetic oligonucleotide primer 448gggagaggtt cagttgggga at 2244930DNAArtificialsynthetic oligonucleotide primer 449gcgaatgcct aatgtgatga taaaaaaata 3045028DNAArtificialsynthetic oligonucleotide primer 450tccccatcat ttatcgaaaa taataatt 2845122DNAArtificialsynthetic oligonucleotide primer 451aataatggag tgacccgctg ct 2245222DNAArtificialsynthetic oligonucleotide primer 452tggtacgagt ggcacgaaat gt 2245322DNAArtificialsynthetic oligonucleotide primer 453gccatccttt cctttcaacc aa 2245422DNAArtificialsynthetic oligonucleotide primer 454tgtaggctat tggaagggtg cg 2245528DNAArtificialsynthetic oligonucleotide primer 455gcgcttataa aggcttgtga aagacact 2845622DNAArtificialsynthetic oligonucleotide primer 456tggttagtgc aatcttggcg gt 2245723DNAArtificialsynthetic oligonucleotide primer 457tgcacccatc aatcacattt ttg 2345825DNAArtificialsynthetic oligonucleotide primer 458gcggttcaag gcttcaagta gtcac 2545922DNAArtificialsynthetic oligonucleotide primer 459ttttttctca cacccatgcc gt 2246022DNAArtificialsynthetic oligonucleotide primer 460ccggttggcg taatgtgtct tt 2246122DNAArtificialsynthetic oligonucleotide primer 461gccagcagcc tgttcagttt tt 2246226DNAArtificialsynthetic oligonucleotide primer 462cccctctttg gccctcacac cttctc 2646324DNAArtificialsynthetic oligonucleotide primer 463atttgaagct cttggtatct tggc 2446427DNAArtificialsynthetic oligonucleotide primer 464caaccatgat aaatgtgagt gagcttg 2746522DNAArtificialsynthetic oligonucleotide primer 465gtcacaattt cacgatccca aa 2246623DNAArtificialsynthetic oligonucleotide primer 466tccattttcc ctttagtcca acg 2346728DNAArtificialsynthetic oligonucleotide primer 467gcgcatacga tttggcattt ttctattg 2846828DNAArtificialsynthetic oligonucleotide primer 468aatttcttac gtttccatag atttctcg 2846922DNAArtificialsynthetic oligonucleotide primer 469tgccctcttc ccaaactagg gt 2247023DNAArtificialsynthetic oligonucleotide primer 470caaccactga ttcaagccaa caa 2347127DNAArtificialsynthetic oligonucleotide primer 471caatttaagc acggtcatat tttctca 2747223DNAArtificialsynthetic oligonucleotide primer 472cgtgatgcag tgaatttttt tcg 2347326DNAArtificialsynthetic oligonucleotide primer 473gggttacttt tctttatcct cctcca 2647426DNAArtificialsynthetic oligonucleotide primer 474gggctatcaa attgactaaa gccaaa 2647526DNAArtificialsynthetic oligonucleotide primer 475acacttgaat catcgagagt tgctaa 2647622DNAArtificialsynthetic oligonucleotide primer 476tgtgctgctt gcttcaattt gg 2247726DNAArtificialsynthetic oligonucleotide primer 477tggcctgtct tatattaccg aaccaa 2647826DNAArtificialsynthetic oligonucleotide primer 478ggtccgtatg caattcttga ctaata 2647924DNAArtificialsynthetic oligonucleotide primer 479tcccccacaa gagaacaaga aggt 2448027DNAArtificialsynthetic oligonucleotide primer 480gcgggaattg gttaatctca tcgtgac 2748122DNAArtificialsynthetic oligonucleotide primer 481tgcgaaaaag cagagtgacc aa 2248223DNAArtificialsynthetic oligonucleotide primer 482tgagcatatt ttgatccgat gcc 2348325DNAArtificialsynthetic oligonucleotide primer 483gttgctttgt tatgtaatgg aagtc 2548424DNAArtificialsynthetic oligonucleotide primer 484gccccacaaa tattcagaag gtaa 2448524DNAArtificialsynthetic oligonucleotide primer 485gcagcggtgt agttcgttct ttct 2448622DNAArtificialsynthetic oligonucleotide primer 486aaatcgtctt ttgtggctgc ct 2248724DNAArtificialsynthetic oligonucleotide primer 487gcaccatgtt ctttttccat caaa 2448824DNAArtificialsynthetic oligonucleotide primer 488ggctcaatta gagcatgcaa catc 2448922DNAArtificialsynthetic oligonucleotide primer 489catgttaaac gtccacccac ca 2249022DNAArtificialsynthetic oligonucleotide primer 490gcgtgaattc gcctaagttt at 2249128DNAArtificialsynthetic oligonucleotide primer 491tccctactct cgtgtcgtta gttatttt 2849228DNAArtificialsynthetic oligonucleotide primer 492agttacatta tttttgtctt tctgccgt 2849324DNAArtificialsynthetic oligonucleotide primer 493gcgcaagtgg ccagctcatc tatt 2449428DNAArtificialsynthetic oligonucleotide primer 494ccctcttatt tcaccctaag acctacaa 2849524DNAArtificialsynthetic oligonucleotide primer 495ggaaatgctt caaaccaaca aaca 2449626DNAArtificialsynthetic oligonucleotide primer 496gcccacatag ttttcatttt tctcca 2649724DNAArtificialsynthetic oligonucleotide primer 497gaggtctagt gctttggtaa ggtt 2449826DNAArtificialsynthetic oligonucleotide primer 498tgtcacacaa ccagtgtctc aaaatc 2649922DNAArtificialsynthetic oligonucleotide primer 499cacaccccag gacccattaa ga 2250023DNAArtificialsynthetic oligonucleotide primer 500aaagcgcaca caatgcaaat aca 2350125DNAArtificialsynthetic oligonucleotide primer 501caaggttacg aactgctcga ataag 2550222DNAArtificialsynthetic oligonucleotide primer 502tgaggaggca agatgatcca aa

2250327DNAArtificialsynthetic oligonucleotide primer 503gcgctttttc ggctgttatt tttaact 2750427DNAArtificialsynthetic oligonucleotide primer 504gcgggtctta cgaacgtgtc acattat 2750522DNAArtificialsynthetic oligonucleotide primer 505cgaacccaaa ccacaaagca ta 2250621DNAArtificialsynthetic oligonucleotide primer 506gcacaatgac aatcacatac a 2150725DNAArtificialsynthetic oligonucleotide primer 507gcgtgtaaaa atctttgaat cttga 2550827DNAArtificialsynthetic oligonucleotide primer 508cacccattat tgaaaataca aggacca 2750919DNAArtificialsynthetic oligonucleotide primer 509gggggatcta ggccatgac 1951028DNAArtificialsynthetic oligonucleotide primer 510gcataatggt ctaataaaag tggagacc 2851124DNAArtificialsynthetic oligonucleotide primer 511tgcttttgga ggaactttgt ctca 2451222DNAArtificialsynthetic oligonucleotide primer 512cattcaaccg tgattgcgaa ga 2251322DNAArtificialsynthetic oligonucleotide primer 513gggagcggat cattcggtga aa 2251421DNAArtificialsynthetic oligonucleotide primer 514gagctacccg agatgatact c 2151524DNAArtificialsynthetic oligonucleotide primer 515ggatcaaatt gggaaacaca aagg 2451622DNAArtificialsynthetic oligonucleotide primer 516ctcacataca tggcagccgt aa 2251722DNAArtificialsynthetic oligonucleotide primer 517tgcctttagc tggtgggaaa aa 2251822DNAArtificialsynthetic oligonucleotide primer 518gcgcgcaaca atcactagta cg 2251923DNAArtificialsynthetic oligonucleotide primer 519ttagaggttt tcggatgagc gtg 2352022DNAArtificialsynthetic oligonucleotide primer 520tatatgcgaa ccctcttaca at 2252122DNAArtificialsynthetic oligonucleotide primer 521gttttggttg atccgcattg gt 2252223DNAArtificialsynthetic oligonucleotide primer 522tttcattacc gcatgttctt gga 2352325DNAArtificialsynthetic oligonucleotide primer 523ttatgttcgt tcatctctga agcct 2552426DNAArtificialsynthetic oligonucleotide primer 524ttctgtccat tctagctcac taaccc 2652521DNAArtificialsynthetic oligonucleotide primer 525aaatcgcgca tctaaattta c 2152625DNAArtificialsynthetic oligonucleotide primer 526acaataactt gttttgcaca ctatt 2552724DNAArtificialsynthetic oligonucleotide primer 527gcgcccacat gattttgtac tgat 2452825DNAArtificialsynthetic oligonucleotide primer 528tatggtaaat attaaccatt gtcct 2552922DNAArtificialsynthetic oligonucleotide primer 529cctcgtttta ttccgaaagc cg 2253019DNAArtificialsynthetic oligonucleotide primer 530gggccatgca cctgctact 1953123DNAArtificialsynthetic oligonucleotide primer 531ttagattcgg acaccggtct act 2353227DNAArtificialsynthetic oligonucleotide primer 532tcttaatttt tttaggaatg gcatcaa 2753326DNAArtificialsynthetic oligonucleotide primer 533cgctatccct ttgtattttc ttttgc 2653427DNAArtificialsynthetic oligonucleotide primer 534gcgggctaac ttatgttact aaacaat 2753526DNAArtificialsynthetic oligonucleotide primer 535cctgtggctg ttatactatg catata 2653622DNAArtificialsynthetic oligonucleotide primer 536gggtggcgtt gacaatgttt ta 2253725DNAArtificialsynthetic oligonucleotide primer 537ttattatcta aacttatatg tgcat 2553824DNAArtificialsynthetic oligonucleotide primer 538gcctcctaag tccgtacaca gcat 2453925DNAArtificialsynthetic oligonucleotide primer 539ccctcactcc tagattattt gttgt 2554023DNAArtificialsynthetic oligonucleotide primer 540ggatttggtt tctgtgtgct gtg 2354118DNAArtificialsynthetic oligonucleotide primer 541ggggcacaag ccacactt 1854227DNAArtificialsynthetic oligonucleotide primer 542gcgggtcaga agatgctacc aaactct 2754322DNAArtificialsynthetic oligonucleotide primer 543tgggcacttg cagtccaaat ag 2254423DNAArtificialsynthetic oligonucleotide primer 544gcgcaaaccg cacaagttta tgt 2354524DNAArtificialsynthetic oligonucleotide primer 545gcgcgagtta gcgaattatt tgtc 2454624DNAArtificialsynthetic oligonucleotide primer 546tgttgaaatt gaccaaaatt ccca 2454726DNAArtificialsynthetic oligonucleotide primer 547gcggaggaat acaagtctct attcaa 2654823DNAArtificialsynthetic oligonucleotide primer 548gcgccgctaa cagacatcca ata 2354923DNAArtificialsynthetic oligonucleotide primer 549tggatttcac ccaagaaaaa agc 2355022DNAArtificialsynthetic oligonucleotide primer 550tcgactaccc gtcgattccg ta 2255123DNAArtificialsynthetic oligonucleotide primer 551ggcacaacca tcaccacctt att 2355226DNAArtificialsynthetic oligonucleotide primer 552cacaatacct gtggctgtta tactat 2655322DNAArtificialsynthetic oligonucleotide primer 553atcgaactgt gaccgtccct tc 2255424DNAArtificialsynthetic oligonucleotide primer 554aagggaagag agtcgtgctt cttt 2455521DNAArtificialsynthetic oligonucleotide primer 555ccagcaaacc cccaggtaaa g 2155622DNAArtificialsynthetic oligonucleotide primer 556gaagaaaacg cgaataaccc ca 2255723DNAArtificialsynthetic oligonucleotide primer 557gcacgcagac tcaagttcat tca 2355822DNAArtificialsynthetic oligonucleotide primer 558aatagttggg tcgtcgaagg gg 2255925DNAArtificialsynthetic oligonucleotide primer 559tccaacttaa cacaagatca gcgaa 2556022DNAArtificialsynthetic oligonucleotide primer 560gaaaagtttt atgttctgag tg 2256125DNAArtificialsynthetic oligonucleotide primer 561ccacacacac tgacacagta aagca 2556217DNAArtificialsynthetic oligonucleotide primer 562ccaaggtctc tcagagg 1756322DNAArtificialsynthetic oligonucleotide primer 563acggaggcac ttcccattgt ta 2256426DNAArtificialsynthetic oligonucleotide primer 564caaaacgaca tgacaaggaa acttca 2656528DNAArtificialsynthetic oligonucleotide primer 565tcctccataa aaattaaaaa cattggaa 2856622DNAArtificialsynthetic oligonucleotide primer 566gcccccagac acaacataat ca 2256722DNAArtificialsynthetic oligonucleotide primer 567cgagagaagc agaagcagag gc 2256822DNAArtificialsynthetic oligonucleotide primer 568gagaaaggtg acgatggacg ct 2256936DNAArtificialsynthetic oligonucleotide primer 569catggtttct cttatcttat agacattgtt gccaag 3657036DNAArtificialsynthetic oligonucleotide primer 570caattcatgg tttctcttat agacattgtt gccaag 3657128DNAArtificialsynthetic oligonucleotide primer 571cactgtccct gctcctgttt caagtatc 2857231DNAArtificialsynthetic oligonucleotide primer 572caattcttgt gggttgaagc cttgttctga c 3157330DNAArtificialsynthetic oligonucleotide primer 573ggaatcaact tcttcgtgag tgggttgttc 3057428DNAArtificialsynthetic oligonucleotide primer 574tggtggctat ggaaatctca tgtgtgga 2857533DNAArtificialsynthetic oligonucleotide primer 575ctctcattta ccaaactcca acatttgatc acc 3357629DNAArtificialsynthetic oligonucleotide primer 576cacactggta gatgggaagc aagaatagg 2957732DNAArtificialsynthetic oligonucleotide primer 577gaagaagatt ccacccagat catcatcagt ag 3257826DNAArtificialsynthetic oligonucleotide primer 578gcttgtgcag ctccaatcgg tgtaac 2657927DNAArtificialsynthetic oligonucleotide primer 579gtgcaatcca agacatctgg ttcggac 2758031DNAArtificialsynthetic oligonucleotide primer 580cagctaaacc ttacaaggat gattggtcaa g 3158128DNAArtificialsynthetic oligonucleotide primer 581ccctggactg aagttgccat aatgtatc 2858223DNAArtificialsynthetic oligonucleotide primer 582gctggttggg agaaagcact tcc 2358330DNAArtificialsynthetic oligonucleotide primer 583gaatctaaca ttacgctctg ctggagtatc 3058428DNAArtificialsynthetic oligonucleotide primer 584gagggactat gtgaaatgga gaggagtg 2858531DNAArtificialsynthetic oligonucleotide primer 585gtatgctaaa agaggagact tgactggtga g 3158632DNAArtificialsynthetic oligonucleotide primer 586gatgaaggaa ccaacacttg cataacaatt tg 3258727DNAArtificialsynthetic oligonucleotide primer 587tgtcagcact cctcactcat ttgccga 2758829DNAArtificialsynthetic oligonucleotide primer 588cacttaacag gagtgctcct gatcaccag 2958936DNAArtificialsynthetic oligonucleotide primer 589gagaacaagg acaaatcaat aggtgagacg aagaaa 3659028DNAArtificialsynthetic oligonucleotide primer 590ctcatctgct cagaaccttc agtcagtc 2859133DNAArtificialsynthetic oligonucleotide primer 591cggatcatgt ctagtacatt agagatgctt gtg 3359232DNAArtificialsynthetic oligonucleotide primer 592ctacacttct aatgcctatt taggtgtgct tg 3259332DNAArtificialsynthetic oligonucleotide primer 593gtcatatcta gggagatttc taaccagttg tc 3259427DNAArtificialsynthetic oligonucleotide primer 594taggcagcgt gacaaactga gcatagg 2759530DNAArtificialsynthetic oligonucleotide primer 595gggttgatgt ccgatgggta aatgaagttg 3059636DNAArtificialsynthetic oligonucleotide primer 596gcactaatac tttagttgac ttttgaggtg gttgag 3659737DNAArtificialsynthetic oligonucleotide primer 597gctatgtggt agaagtatat gaaaaggtag atgacag 3759837DNAArtificialsynthetic oligonucleotide primer 598gaatatacta gcttgatgcc tatttgtttc taaaccc 3759933DNAArtificialsynthetic oligonucleotide primer 599agcagtcata caatgctctt tattgtggtg aag 3360033DNAArtificialsynthetic oligonucleotide primer 600gctcatagcc tgcttcttaa tcttgttatt ctg 3360135DNAArtificialsynthetic oligonucleotide primer 601ctatttgttt caggagtttc acaaccatct caagt 3560230DNAArtificialsynthetic oligonucleotide primer 602catcttgacc agtcaccaat ctgagtacag 3060330DNAArtificialsynthetic oligonucleotide primer 603ggcttcagtg agaaaggtgg atcaaatgga 3060432DNAArtificialsynthetic oligonucleotide primer 604caacgtgtaa aatcaagaga ttgagcttct gg 3260530DNAArtificialsynthetic oligonucleotide primer 605tcggtgtgtt caactatgac tttggttctg 3060636DNAArtificialsynthetic oligonucleotide primer 606cccccaacaa aactaaaaat agaaccctca acaacc 3660735DNAArtificialsynthetic oligonucleotide primer 607ggtccaagaa cattatgatc ttgaacaatc ttcac 3560830DNAArtificialsynthetic oligonucleotide primer 608tggctagagc atcaacacat ctataccttc 3060933DNAArtificialsynthetic oligonucleotide primer 609cattgggcat gattcttgaa tagccttttt acc 3361030DNAArtificialsynthetic oligonucleotide primer 610gagggctatg ttttcttctc cagatgtgag 3061126DNAArtificialsynthetic oligonucleotide primer 611aaggtcggct tggtggttaa aggcag 2661233DNAArtificialsynthetic oligonucleotide primer 612gccttttatg cacatttttc ctggggatct aac 3361337DNAArtificialsynthetic oligonucleotide primer 613ctcaatgtca tgggatcaat ttggaaattc aatgacc 3761437DNAArtificialsynthetic oligonucleotide primer 614gattacatta attaccgcta tgactatatc ttgggac 3761532DNAArtificialsynthetic oligonucleotide primer 615gctaccttct ccattgcttc tatgtattgg tc 3261632DNAArtificialsynthetic oligonucleotide primer 616gggcatcaca tacatgaaaa caactacact tg 3261727DNAArtificialsynthetic oligonucleotide primer 617caacagctct cttccaccac aatcctg 2761833DNAArtificialsynthetic oligonucleotide primer 618gagattggaa attgtagctc tctttacttg ctg 3361935DNAArtificialsynthetic oligonucleotide primer 619ctttgaggac ttatttggtt gttataggca tttgg 3562030DNAArtificialsynthetic oligonucleotide primer 620gtgtttccct ccatttttgc caaaagacag 3062131DNAArtificialsynthetic oligonucleotide primer 621tatacacact aagaattcgc tcgctgtaca a 3162228DNAArtificialsynthetic oligonucleotide primer 622ggtctagact ttcactcaga caaggaac 2862338DNAArtificialsynthetic oligonucleotide primer 623caaaatacta cagacctaat ttgtaactaa ttgctccc 3862429DNAArtificialsynthetic oligonucleotide primer 624gggaagaaga agaacactcg gtacagtag 2962537DNAArtificialsynthetic oligonucleotide primer 625aagctaggaa atccacactc aaattatcga cttgtgt 3762627DNAArtificialsynthetic oligonucleotide primer 626gacctgaagc aaaacgccac catttcc 2762726DNAArtificialsynthetic oligonucleotide primer 627cgttggagac gacgccgttt gattac 2662822DNAArtificialsynthetic oligonucleotide primer 628cagtcgacac

gtcttctact cc 2262921DNAArtificialsynthetic oligonucleotide primer 629tggaaggcat gtcggaactt g 2163030DNAArtificialsynthetic oligonucleotide primer 630cctttttgcc ctcacttcat gccttctatg 3063127DNAArtificialsynthetic oligonucleotide primer 631gcataaccca agagctggac tgacaag 2763228DNAArtificialsynthetic oligonucleotide primer 632caagctctgc tgccaggtta agtgtttc 2863332DNAArtificialsynthetic oligonucleotide primer 633gactagaaca aattggggct agtgtgtttg ag 3263426DNAArtificialsynthetic oligonucleotide primer 634tggacttgcg ggactatgcc ttagag 2663528DNAArtificialsynthetic oligonucleotide primer 635gcaggaacac gttcgtaacc atcaactg 2863632DNAArtificialsynthetic oligonucleotide primer 636gtccctttct gaaccactta aagagtcaac ag 3263730DNAArtificialsynthetic oligonucleotide primer 637ggcatagtga gttgaatacc aggaggaatc 3063827DNAArtificialsynthetic oligonucleotide primer 638attgaagggt gggcgttacc aggttac 2763932DNAArtificialsynthetic oligonucleotide primer 639gagttaatgg ggctatgcta ttggctattc ac 3264036DNAArtificialsynthetic oligonucleotide primer 640gtcactatat ggagtcaagg taattattgt gttcac 3664138DNAArtificialsynthetic oligonucleotide primer 641ggtctagagt ttgaatatta gtaatgactt gtattgac 3864235DNAArtificialsynthetic oligonucleotide primer 642gcatattgtg ccatagagag agaaaatgta gtaag 3564334DNAArtificialsynthetic oligonucleotide primer 643cgctactgca agttatcagt caagagatta ttcc 3464430DNAArtificialsynthetic oligonucleotide primer 644gccgtgtaag cgtgtttacc aatctagttg 3064532DNAArtificialsynthetic oligonucleotide primer 645caaaactgag cgaaacttgt gttgggagaa ag 3264631DNAArtificialsynthetic oligonucleotide primer 646gtggggactc tttattcgaa gtttgctgaa c 3164736DNAArtificialsynthetic oligonucleotide primer 647ctcatgtaac caactctcta tgaagtttga gatcca 3664833DNAArtificialsynthetic oligonucleotide primer 648ctctaatcgg atttggtgtt tcacttcggt aag 3364929DNAArtificialsynthetic oligonucleotide primer 649gatggctgtc attgctacag aggagtatc 2965038DNAArtificialsynthetic oligonucleotide primer 650gtgactccaa aggaaagaga aatgtttctt aaatcatc 3865132DNAArtificialsynthetic oligonucleotide primer 651ggatagcaag tcaatttcat gccttgtgat ag 3265234DNAArtificialsynthetic oligonucleotide primer 652gcaggacatg aagatgtact tagtgaatgt gaag 3465327DNAArtificialsynthetic oligonucleotide primer 653actggaagag ggtgcttagg gaatctg 2765430DNAArtificialsynthetic oligonucleotide primer 654gagaatctag tctaccacca taccacgaac 3065535DNAArtificialsynthetic oligonucleotide primer 655gggactctct ttatattgga aggtataact cagtg 3565633DNAArtificialsynthetic oligonucleotide primer 656gttggaccct tgtaattaga cccgaaacaa atg 3365730DNAArtificialsynthetic oligonucleotide primer 657atctgtccaa cgatctctcc atgttcattc 3065833DNAArtificialsynthetic oligonucleotide primer 658cgaataagaa gttgggtatc acttacacgt tgg 3365927DNAArtificialsynthetic oligonucleotide primer 659gatggggttc tagactggga tctggat 2766032DNAArtificialsynthetic oligonucleotide primer 660cttttcctac aggattgtca ggcttatcgt ca 3266127DNAArtificialsynthetic oligonucleotide primer 661gaagagtaac agagtctacg caccgac 2766237DNAArtificialsynthetic oligonucleotide primer 662gtcaacgaac atactatgca tgatgatttc tgattag 3766328DNAArtificialsynthetic oligonucleotide primer 663catatgcaga cagcaggcta aggaactc 2866438DNAArtificialsynthetic oligonucleotide primer 664gcagcaatat aaccaggatt cagaattaat ctagttag 3866530DNAArtificialsynthetic oligonucleotide primer 665cgatggggtt gacttagaaa tggcatatac 3066628DNAArtificialsynthetic oligonucleotide primer 666gcaccaattc ctcaagcata ctccaaac 2866730DNAArtificialsynthetic oligonucleotide primer 667ctgacaaggt gttttggtag ggagagattc 3066832DNAArtificialsynthetic oligonucleotide primer 668gcatcctccg ttactccaat cagagtttcc at 3266930DNAArtificialsynthetic oligonucleotide primer 669ctgacaaggt gttttggtag ggagagattc 3067032DNAArtificialsynthetic oligonucleotide primer 670gcatcctccg ttactccaat cagagtttcc at 3267132DNAArtificialsynthetic oligonucleotide primer 671cacactatca acacctattg gtgaccattg ta 3267233DNAArtificialsynthetic oligonucleotide primer 672ggagggtgct tatgtaaatg atgtaaagac cat 3367335DNAArtificialsynthetic oligonucleotide primer 673gatgaccatt ttgattccct catgctatta gtacc 3567433DNAArtificialsynthetic oligonucleotide primer 674ccaataagtt agcagcatgt ggatcacagt gta 3367530DNAArtificialsynthetic oligonucleotide primer 675gtctctcgga gttgcttcaa ttgctcatac 3067636DNAArtificialsynthetic oligonucleotide primer 676gagagtgtgg aattgtaagt cattgattga aaactc 3667730DNAArtificialsynthetic oligonucleotide primer 677gtctctcgga gttgcttcaa ttgctcatac 3067836DNAArtificialsynthetic oligonucleotide primer 678gagagtgtgg aattgtaagt cattgattga aaactc 3667926DNAArtificialsynthetic oligonucleotide primer 679gcagaaggag cattgaggct ttccag 2668032DNAArtificialsynthetic oligonucleotide primer 680gaaaaggttt gttatgcttc gtactctgtc tc 3268133DNAArtificialsynthetic oligonucleotide primer 681catgaagctc caccatttgc tagtacatga aac 3368233DNAArtificialsynthetic oligonucleotide primer 682ccagagttac caaaccatct gtgagaaata tcc 3368333DNAArtificialsynthetic oligonucleotide primer 683catgaagctc caccatttgc tagtacatga aac 3368433DNAArtificialsynthetic oligonucleotide primer 684ccagagttac caaaccatct gtgagaaata tcc 3368528DNAArtificialsynthetic oligonucleotide primer 685caaacgctcc caacagcttc agaatctc 2868628DNAArtificialsynthetic oligonucleotide primer 686ttgaaggttg taagagtctc ggtcgtcg 2868730DNAArtificialsynthetic oligonucleotide primer 687cccattcttc atgtactcat acaccaagag 3068833DNAArtificialsynthetic oligonucleotide primer 688gcagccacca ataatttctc atttgacaac aag 3368931DNAArtificialsynthetic oligonucleotide primer 689ctctgtatat gayatatgtg ctcagtgcct c 3169032DNAArtificialsynthetic oligonucleotide primer 690gacttaccaa atgagtttga ccaggtttta cc 3269130DNAArtificialsynthetic oligonucleotide primer 691aggattcaac ctctagccat gatgatgttg 3069228DNAArtificialsynthetic oligonucleotide primer 692ccaagctctt tccgtgtgta tcaatctg 2869312DNAArtificialoligonucleotide probe 693gtttcagata ac 1269412DNAArtificialoligonucleotide probe 694gaatgacttt ga 1269513DNAArtificialoligonucleotide probe 695tcattctttc atg 1369612DNAArtificialoligonucleotide probe 696tctccagaaa ca 1269710DNAArtificialoligonucleotide probe 697gtgatccgtg 1069813DNAArtificialoligonucleotide probe 698atcttttcag gtt 1369913DNAArtificialoligonucleotide probe 699ggattacata cta 1370013DNAArtificialoligonucleotide probe 700tttgaagctt tat 1370113DNAArtificialoligonucleotide probe 701aagaatcttc cta 1370215DNAArtificialoligonucleotide probe 702aatctaaaat ttagt 1570314DNAArtificialoligonucleotide probe 703actaaattta tacc 1470411DNAArtificialoligonucleotide probe 704attaggggca g 1170512DNAArtificialoligonucleotide probe 705actatagttc gc 1270612DNAArtificialoligonucleotide probe 706aacctttctg tc 1270712DNAArtificialoligonucleotide probe 707ttgaggattt ag 1270812DNAArtificialoligonucleotide probe 708tctcaacttg ga 1270912DNAArtificialoligonucleotide probe 709ttcagtcaaa cc 1271013DNAArtificialoligonucleotide probe 710ttcttttgtg aca 1371112DNAArtificialoligonucleotide probe 711tgtgacaacc ga 1271214DNAArtificialoligonucleotide probe 712aatctttttt aaag 1471313DNAArtificialoligonucleotide probe 713tcatctgtga taa 1371412DNAArtificialoligonucleotide probe 714aagagaaggc ta 1271513DNAArtificialoligonucleotide probe 715atataagtaa ggg 1371610DNAArtificialoligonucleotide probe 716gcatgtcgac 1071713DNAArtificialoligonucleotide probe 717ttggaagtta tac 1371811DNAArtificialoligonucleotide probe 718ggcatgtgag t 1171914DNAArtificialoligonucleotide probe 719attaacagta aagt 1472015DNAArtificialoligonucleotide probe 720tatctatgta tatta 1572111DNAArtificialoligonucleotide probe 721tgggaatgat g 1172215DNAArtificialoligonucleotide probe 722taaataaata agatg 1572313DNAArtificialoligonucleotide probe 723aaaaaaaatg agg 1372412DNAArtificialoligonucleotide probe 724tcaatgttgg at 1272513DNAArtificialoligonucleotide probe 725ttgtgaccaa tat 1372611DNAArtificialoligonucleotide probe 726atcaagccca a 1172711DNAArtificialoligonucleotide probe 727agaagctcgt g 1172812DNAArtificialoligonucleotide probe 728gaaaaagaaa gg 1272914DNAArtificialoligonucleotide probe 729acatataata gtag 1473014DNAArtificialoligonucleotide probe 730ttttgtatct gtat 1473112DNAArtificialoligonucleotide probe 731ttaacttgcc ag 1273214DNAArtificialoligonucleotide probe 732aatgataatt tagt 1473313DNAArtificialoligonucleotide probe 733gaatgaattt ttc 1373411DNAArtificialoligonucleotide probe 734acactgctta c 1173513DNAArtificialoligonucleotide probe 735acaactaata agg 1373614DNAArtificialoligonucleotide probe 736ttctgataaa aaaa 1473711DNAArtificialoligonucleotide probe 737tgtaatgcgt g 1173813DNAArtificialoligonucleotide probe 738gacaatctaa aaa 1373915DNAArtificialoligonucleotide probe 739taataataat tgtgt 1574014DNAArtificialoligonucleotide probe 740ttccttcttt tttt 1474111DNAArtificialoligonucleotide probe 741ggaacgttac c 1174214DNAArtificialoligonucleotide probe 742aattttttag tatg 1474313DNAArtificialoligonucleotide probe 743ttatagacac ttg 1374414DNAArtificialoligonucleotide probe 744ataaaccata tatg 1474514DNAArtificialoligonucleotide probe 745ttaattacct taag 1474611DNAArtificialoligonucleotide probe 746atgccatttt g 1174714DNAArtificialoligonucleotide probe 747taatatctta tgca 1474812DNAArtificialoligonucleotide probe 748agtgcgatga aa 1274912DNAArtificialoligonucleotide probe 749gaggagatgt ag 1275014DNAArtificialoligonucleotide probe 750taaaattgtt ggtt 1475114DNAArtificialoligonucleotide probe 751tgaagaaaaa tatg 1475211DNAArtificialoligonucleotide probe 752ctgtccacta a 1175311DNAArtificialoligonucleotide probe 753agaggcagtg a

1175412DNAArtificialoligonucleotide probe 754gtttctgata ac 1275513DNAArtificialoligonucleotide probe 755gaatgatttt gac 1375613DNAArtificialoligonucleotide probe 756tcattcattc atg 1375710DNAArtificialoligonucleotide probe 757gtttcgggag 1075812DNAArtificialoligonucleotide probe 758atcacgaatc ac 1275913DNAArtificialoligonucleotide probe 759tatggagtaa ttg 1376014DNAArtificialoligonucleotide probe 760tggattttat acta 1476114DNAArtificialoligonucleotide probe 761tttgaatctt tatc 1476214DNAArtificialoligonucleotide probe 762aaagaatatt ccta 1476314DNAArtificialoligonucleotide probe 763atctaacatt tagt 1476413DNAArtificialoligonucleotide probe 764ggtatacatt tag 1376511DNAArtificialoligonucleotide probe 765attagggggc a 1176612DNAArtificialoligonucleotide probe 766actatacttc gc 1276711DNAArtificialoligonucleotide probe 767accttgctgt c 1176812DNAArtificialoligonucleotide probe 768ttgagcattt ag 1276913DNAArtificialoligonucleotide probe 769tctcaatttg gaa 1377012DNAArtificialoligonucleotide probe 770ttcagttaaa cc 1277112DNAArtificialoligonucleotide probe 771ttctttggtg ac 1277211DNAArtificialoligonucleotide probe 772gtgacacaac c 1177314DNAArtificialoligonucleotide probe 773aatcttcttt aaag 1477413DNAArtificialoligonucleotide probe 774tcatgtgtga taa 1377512DNAArtificialoligonucleotide probe 775aagagatggc ta 1277614DNAArtificialoligonucleotide probe 776aatataaata aggg 1477710DNAArtificialoligonucleotide probe 777gcatctcgac 1077813DNAArtificialoligonucleotide probe 778ttggaagata tac 1377910DNAArtificialoligonucleotide probe 779ggcttgcgag 1078015DNAArtificialoligonucleotide probe 780tattaacatt aaagt 1578116DNAArtificialoligonucleotide probe 781tatctatata tattaa 1678211DNAArtificialoligonucleotide probe 782atcatcccca a 1178314DNAArtificialoligonucleotide probe 783aaataagtaa gatg 1478413DNAArtificialoligonucleotide probe 784aaaaaatatg agg 1378513DNAArtificialoligonucleotide probe 785tcaatgatgg ata 1378613DNAArtificialoligonucleotide probe 786atattgatca caa 1378711DNAArtificialoligonucleotide probe 787tgggtttgat c 1178810DNAArtificialoligonucleotide probe 788gaaggtcgtg 1078913DNAArtificialoligonucleotide probe 789gaaaaaaaaa gga 1379013DNAArtificialoligonucleotide probe 790acatatagta gta 1379112DNAArtificialoligonucleotide probe 791tttgtggctg ta 1279212DNAArtificialoligonucleotide probe 792ttaactagcc ag 1279313DNAArtificialoligonucleotide probe 793aatgatcatt tag 1379413DNAArtificialoligonucleotide probe 794aatgaacttt ttc 1379512DNAArtificialoligonucleotide probe 795tttttgctag ag 1279613DNAArtificialoligonucleotide probe 796tacaactaag gta 1379713DNAArtificialoligonucleotide probe 797tctgatgaaa aaa 1379811DNAArtificialoligonucleotide probe 798tgtaacgcgt g 1179913DNAArtificialoligonucleotide probe 799gacaatttaa aaa 1380013DNAArtificialoligonucleotide probe 800aataatgatt gtg 1380113DNAArtificialoligonucleotide probe 801tccttccttt ttt 1380212DNAArtificialoligonucleotide probe 802tggaacatta cc 1280314DNAArtificialoligonucleotide probe 803aatttttgag tatg 1480412DNAArtificialoligonucleotide probe 804tataggcact tg 1280514DNAArtificialoligonucleotide probe 805ataaacctta tatg 1480614DNAArtificialoligonucleotide probe 806ttaattatct taag 1480712DNAArtificialoligonucleotide probe 807atgccctttt gt 1280813DNAArtificialoligonucleotide probe 808aatatcgtat gca 1380912DNAArtificialoligonucleotide probe 809agtgcactga aa 1281012DNAArtificialoligonucleotide probe 810agaggagatg ta 1281114DNAArtificialoligonucleotide probe 811taaaattatt ggtt 1481213DNAArtificialoligonucleotide probe 812gaacaaaaag atg 1381312DNAArtificialoligonucleotide probe 813actgtcaact aa 1281411DNAArtificialoligonucleotide probe 814agagccagtg a 1181513DNAArtificialoligonucleotide probe 815tcatctctga taa 1381614DNAArtificialoligonucleotide probe 816ttggaatata tact 1481714DNAArtificialoligonucleotide probe 817agatgttaga gtta 1481812DNAArtificialoligonucleotide probe 818tgtaacgcat gt 1281913DNAArtificialoligonucleotide probe 819attttttggt atg 13

* * * * *
[Image]
[View Shopping Cart] [Add to Shopping Cart]
[Top]
[Home] [Boolean Search] [Manual Search] [Number Search] [Help]